ID: 1140132190

View in Genome Browser
Species Human (GRCh38)
Location 16:72173064-72173086
Sequence AACCAGGTTTAGAAGCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140132190_1140132194 -6 Left 1140132190 16:72173064-72173086 CCACCAAGCTTCTAAACCTGGTT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1140132194 16:72173081-72173103 CTGGTTCAGCACCTCACTGGAGG 0: 1
1: 0
2: 2
3: 7
4: 135
1140132190_1140132197 11 Left 1140132190 16:72173064-72173086 CCACCAAGCTTCTAAACCTGGTT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1140132197 16:72173098-72173120 TGGAGGAGTGGCCTTTGCAAAGG 0: 1
1: 0
2: 0
3: 25
4: 272
1140132190_1140132199 28 Left 1140132190 16:72173064-72173086 CCACCAAGCTTCTAAACCTGGTT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1140132199 16:72173115-72173137 CAAAGGCCTTCATATCTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 232
1140132190_1140132195 -1 Left 1140132190 16:72173064-72173086 CCACCAAGCTTCTAAACCTGGTT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1140132195 16:72173086-72173108 TCAGCACCTCACTGGAGGAGTGG 0: 1
1: 0
2: 2
3: 18
4: 178
1140132190_1140132192 -9 Left 1140132190 16:72173064-72173086 CCACCAAGCTTCTAAACCTGGTT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1140132192 16:72173078-72173100 AACCTGGTTCAGCACCTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140132190 Original CRISPR AACCAGGTTTAGAAGCTTGG TGG (reversed) Intronic
903259545 1:22123986-22124008 AACCAGGTAGAGAAGGCTGGAGG - Intronic
903900837 1:26644038-26644060 AAAAAAGTTTTGAAGCTTGGGGG - Intergenic
905203785 1:36331197-36331219 AATCAGATTCAGAAGCTGGGTGG - Intergenic
906855420 1:49298829-49298851 TAGAAGGTTTAGAACCTTGGAGG - Intronic
907806347 1:57824208-57824230 AGCCAGGATTTGAAGCTTGGTGG + Intronic
909143637 1:71899398-71899420 GACCAGATTAAGAAGGTTGGGGG + Intronic
910525163 1:88169444-88169466 ATCCTGGTTTGGTAGCTTGGAGG - Intergenic
912886622 1:113481277-113481299 AACTAGGTTTATAAGATTTGGGG - Intronic
915575186 1:156771146-156771168 AACAATGTATAAAAGCTTGGAGG + Intronic
915848152 1:159290595-159290617 AGCCAGGATTTGAAGCTTAGAGG - Intronic
917297471 1:173536552-173536574 GAGGAGGTTTAGAAGCCTGGAGG - Intronic
917968667 1:180193985-180194007 ATCCAGGTTTAGGAGTTTTGGGG + Intronic
919531095 1:198721104-198721126 AACCATCTTTTGAAGATTGGGGG - Intronic
920254003 1:204642049-204642071 GACCAGGTAAAGCAGCTTGGAGG + Intronic
923609132 1:235474101-235474123 AAACAGGTTTAGGAGATAGGTGG - Intronic
923644680 1:235806179-235806201 AAACAGTTTTATAGGCTTGGTGG - Exonic
1066493535 10:35918324-35918346 AATCAGGTCTAAAAGCTGGGTGG + Intergenic
1068527118 10:58143080-58143102 AAAGTGGTGTAGAAGCTTGGTGG + Intergenic
1068905642 10:62318394-62318416 ATCCAGGATGAGAATCTTGGAGG + Intergenic
1069597288 10:69680523-69680545 AGCCAGGCTTTGAAGCTGGGAGG - Intergenic
1073712913 10:106065534-106065556 AACCAGGACAAGGAGCTTGGTGG + Intergenic
1075628103 10:123978629-123978651 AACCAGGTTAGGAAGATTAGAGG - Intergenic
1076092008 10:127694541-127694563 ATCAAAGCTTAGAAGCTTGGAGG + Intergenic
1078942248 11:16020457-16020479 AACCATGTAGAGGAGCTTGGAGG - Intronic
1079667877 11:23130730-23130752 TACCAGGTTAAGAAGCTTTTGGG + Intergenic
1079738819 11:24032367-24032389 TACCAGGTTAAGAAGCTTTTGGG + Intergenic
1082800744 11:57413094-57413116 CAACAGGATTAGAAGCTTGGAGG - Intronic
1083243744 11:61409568-61409590 TAACAGGTTTAGAGGCTTTGTGG - Intronic
1085152378 11:74262518-74262540 AACCAGGATCTGGAGCTTGGGGG - Intronic
1085711908 11:78836771-78836793 AAACTGGTTTAGAAACATGGTGG + Intronic
1086454306 11:86946345-86946367 AAGGAGGTTTAAAAGCTTTGAGG + Exonic
1087157852 11:94922267-94922289 ACACAGGTATAGAATCTTGGGGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1087853795 11:103065925-103065947 AATCAGATTTAGAAGCTTAAAGG + Intronic
1089061602 11:115630397-115630419 AACCAGTTTTACTAGCTGGGGGG - Intergenic
1090214021 11:124944354-124944376 AACCAGATGCAGAATCTTGGAGG - Intergenic
1095551840 12:43451387-43451409 TACTGGGTTTAGAAGATTGGAGG - Intronic
1097629683 12:62044844-62044866 CACATGGTTTAGAAGCTTGCAGG - Intronic
1099652429 12:85445357-85445379 AACCAGGTTTAGAATCTGTGGGG - Intergenic
1103934164 12:124466483-124466505 AACCTGGCTTTGGAGCTTGGAGG - Intronic
1104632464 12:130414822-130414844 AACCACTTTTGGAAGCTGGGTGG - Intronic
1106563419 13:30865582-30865604 ACCCAGTTTTATAAGCATGGAGG + Intergenic
1107314412 13:39115873-39115895 AATCAGGTTAAGAAGCTTTTGGG + Intergenic
1107332522 13:39317090-39317112 GAACAGGTTTATATGCTTGGAGG + Intergenic
1108536368 13:51384620-51384642 GAACAGGTTTTGTAGCTTGGGGG - Intronic
1112081091 13:95971470-95971492 GACCAGGTGTAGGAGCTGGGGGG + Intronic
1115812496 14:37125108-37125130 AACCAGGACTAGAGCCTTGGTGG - Intronic
1119687940 14:76647747-76647769 CACCATGTTTAGAATCTTGCTGG - Intergenic
1124094687 15:26638163-26638185 GACCAGGTTCAGAACCCTGGTGG - Intronic
1125711986 15:41794571-41794593 AACCAGTTTTAGATACTTTGTGG + Intronic
1130886328 15:88095669-88095691 CCCCAGGTTTAGAAGGTTTGAGG + Intronic
1131793842 15:95993139-95993161 AAGCAAGTTTAGAAGAGTGGTGG + Intergenic
1136403964 16:30032618-30032640 AAACAGGTTTAGAAATTTTGTGG + Intronic
1140132190 16:72173064-72173086 AACCAGGTTTAGAAGCTTGGTGG - Intronic
1148590181 17:48810417-48810439 AAACAGGGAGAGAAGCTTGGGGG - Intronic
1149106843 17:52978944-52978966 AAACAGCTTTAGAAAGTTGGTGG - Intergenic
1149234396 17:54573188-54573210 AACCAGGCATAGAGGCTGGGAGG + Intergenic
1150282964 17:63940152-63940174 AATCAGGTTTTGAGGCTTTGAGG + Exonic
1151505816 17:74526293-74526315 AAGCAGGTCTAGAAGCTGGTGGG - Intronic
1155084979 18:22449440-22449462 AATCAGCTTCAGAAGCTTTGGGG - Intergenic
1156106843 18:33673888-33673910 AAGCAGGTTTGAAAGATTGGGGG - Intronic
1158062411 18:53361350-53361372 AACAATGTTTAGGAGATTGGGGG - Intronic
1160737704 19:671658-671680 CACCAGGTTCAGAAGCTTCCAGG - Intergenic
1163827631 19:19532539-19532561 GACCGGGTTCAGAAGCTTGGCGG + Intronic
1164144853 19:22505680-22505702 ACCCAGGGTTAGAAGCTGGCAGG - Intronic
1165067593 19:33237991-33238013 AACCAGGTTTAGATGCTCACGGG - Intergenic
1166177144 19:41082137-41082159 AACCAGGGTAAGAAGCTGTGGGG + Intergenic
927476081 2:23415091-23415113 ACCCACTTTTGGAAGCTTGGTGG - Intronic
929737612 2:44566996-44567018 AGCCAAATTCAGAAGCTTGGGGG + Intronic
935952271 2:108341164-108341186 TATCAGGTTAAGAAGCTTTGGGG + Intergenic
937056693 2:118943602-118943624 AACCAGGTGTAGAGCCCTGGAGG + Intronic
941262687 2:163317482-163317504 AACCAGATTTAGAAGTTTGGAGG + Intergenic
944663511 2:201940364-201940386 CACCAGGTTCAGAAACTTGTGGG + Intergenic
944956953 2:204822981-204823003 AATCAGGTTTGAAAGTTTGGGGG + Intronic
946497040 2:220205231-220205253 AAAGAGCTTGAGAAGCTTGGCGG + Intergenic
947986121 2:234449018-234449040 ACTCAGGTTTAGACCCTTGGAGG - Intergenic
948182584 2:235994141-235994163 AACCATGTTATGAAGCTTTGGGG - Intronic
1169070792 20:2728679-2728701 AATCAGGTCTAGAAGCTGAGGGG - Intronic
1170301663 20:14890845-14890867 AACCAGATTTAGCAACATGGAGG + Intronic
1171749608 20:29036011-29036033 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
1173059322 20:39646521-39646543 AAGCAGGCTTAGAAAGTTGGTGG - Intergenic
1175284950 20:57831647-57831669 AATCAGGTTGAGAATCTTTGGGG - Intergenic
1176315628 21:5239989-5240011 AATTAGGTTGAGAAGTTTGGGGG + Intergenic
1177617710 21:23545714-23545736 TACCAGCTTTAGTAGCTGGGGGG + Intergenic
1180393423 22:12305942-12305964 AATTAGGTTGAGAAGTTTGGGGG + Intergenic
1180406326 22:12558826-12558848 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
1180987844 22:19915989-19916011 AACCATGCTGAGAAGCATGGAGG + Intronic
951153243 3:19318089-19318111 TATCAGCTTAAGAAGCTTGGGGG - Intronic
951218223 3:20043583-20043605 AAGCAGTTGTGGAAGCTTGGAGG + Intronic
953981643 3:47416238-47416260 ACCCAGGTTCACCAGCTTGGAGG + Intronic
954666901 3:52259394-52259416 AACCACATTTGGAAGCTTGGTGG - Intronic
955017555 3:55087087-55087109 AACCATGTTTAGCTGCTTGGAGG - Intergenic
957506969 3:81134575-81134597 AATAAGCTTTAGCAGCTTGGAGG - Intergenic
959424622 3:106171133-106171155 AACCAGAGTTAGAAGATTGAAGG + Intergenic
961044601 3:123699887-123699909 AACCTGGTTTAGCAGGTAGGAGG - Intronic
961061163 3:123830517-123830539 AAGCAGGTTTAGCACCATGGGGG + Intronic
961079747 3:124016156-124016178 AATCACGTTCAGAAGCTTAGGGG - Intergenic
964283976 3:155097688-155097710 AAACATGTTTGGAAGCTAGGAGG + Intronic
970115643 4:12692389-12692411 AAATAATTTTAGAAGCTTGGTGG - Intergenic
972459823 4:39290943-39290965 AATTATGTTTAGAAGCTTGAAGG - Intronic
973204449 4:47544475-47544497 AACCAGTTTTTGAAGCTGGAAGG + Intronic
975775994 4:77787869-77787891 AAAGAGGTTTAGAAGCTTGCTGG + Intronic
985078937 4:186245171-186245193 TAAGAGGTTTAGAAGCCTGGCGG + Intronic
985431486 4:189885563-189885585 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
986478350 5:8159042-8159064 AAGCAGGTTAAGAAGTCTGGCGG + Intergenic
988909236 5:35823176-35823198 AAACATGTTTATCAGCTTGGAGG - Intergenic
993608305 5:90022253-90022275 AAACATGTTTCCAAGCTTGGAGG + Intergenic
994515255 5:100763708-100763730 TACCTGGTTTATAAGCTTGATGG - Intergenic
995775031 5:115715921-115715943 AACCAGCTACAGAAGCTTGTGGG + Intergenic
998568839 5:143239260-143239282 AAACAGGTTTAGAAACTTGCAGG + Intergenic
999313620 5:150569696-150569718 AACCAGGTTTGGGAGCTTCTGGG + Intergenic
999775401 5:154808853-154808875 AACCAGTATTAGAATCTTGTGGG + Intronic
1004122966 6:12843382-12843404 AATCTGGTGTAGAAGCTTGAAGG + Intronic
1010275573 6:73965087-73965109 AACCAGTTTTAGAAGCATGTAGG + Intergenic
1022770723 7:33469788-33469810 AACCAGGTTTACATGCTTTCTGG - Intronic
1028331162 7:89593913-89593935 TACAAGGTTTAGTAGCTTTGAGG + Intergenic
1028592101 7:92507941-92507963 AACTAATTTTAAAAGCTTGGAGG - Intronic
1032600503 7:133288762-133288784 AACCAGGATTAGAATTTTGGAGG + Intronic
1033195454 7:139323536-139323558 AATCAGGTCCAGAAGCTTGCAGG - Intergenic
1034158688 7:148976468-148976490 GACCAGGTCTAGAGGCTGGGAGG + Intergenic
1034730809 7:153386076-153386098 AACCAGGAATCGAGGCTTGGGGG - Intergenic
1036178709 8:6564993-6565015 AACCATGTCCAGAACCTTGGTGG - Intronic
1037732017 8:21534082-21534104 AACCTGTTTTAGGAACTTGGGGG + Intergenic
1038878537 8:31580032-31580054 AATCAGCTTTAGAAGCTTTGGGG - Intergenic
1042766825 8:72331214-72331236 TACCAGTTTTAGAAACTTGACGG + Intergenic
1046762745 8:118038429-118038451 AACCAGAGTCAGATGCTTGGAGG - Intronic
1047358918 8:124149860-124149882 ACCCAGCTTTAGAAGTTTGGAGG - Intergenic
1048395303 8:134008959-134008981 AACAAGGATTAGAACCTAGGAGG + Intergenic
1049005740 8:139854539-139854561 AACCAGGGTTTGAATCTGGGTGG - Intronic
1049459496 8:142718117-142718139 ACCCAGTTTTAGCAGCTAGGTGG + Intergenic
1053720657 9:40943608-40943630 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
1054345330 9:63908547-63908569 AATTAGGTTGAGAAGTTTGGGGG + Intergenic
1056955307 9:91076312-91076334 GAGCAAGTTTGGAAGCTTGGGGG + Intergenic
1057046022 9:91886710-91886732 AATCAGGTTTTTCAGCTTGGGGG + Intronic
1059164738 9:112067169-112067191 CACCAGGCCTAGAAGATTGGAGG + Intronic
1186180291 X:6967223-6967245 AGCCAGGTCTAGCAGCATGGGGG - Intergenic
1187055074 X:15735200-15735222 AACTATGTTGAGAAGTTTGGGGG - Intronic
1188939833 X:36223871-36223893 AAAGAGGTTAAGAAGTTTGGAGG + Intergenic
1190601415 X:52096761-52096783 AACCAGGAATAGAAGCTTACTGG + Intergenic
1193386197 X:80874251-80874273 AACCAGGTGAAGAAGATTGAAGG + Intergenic
1194133602 X:90111650-90111672 TATCAGGTTAAGAAGCTTTGTGG - Intergenic
1196773788 X:119320833-119320855 TAAGAGGTTTAGAAGCCTGGCGG + Intergenic
1197392734 X:125887603-125887625 GACCAGGCATAGAAGATTGGAGG - Intergenic
1198026636 X:132713787-132713809 AACCAGGTTTAGTATCTCGGGGG - Intronic
1200479385 Y:3681754-3681776 TATCAGGTTAAGAAGCTTTGTGG - Intergenic