ID: 1140134838

View in Genome Browser
Species Human (GRCh38)
Location 16:72196909-72196931
Sequence AATGTAAGTCACACTGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140134838_1140134839 7 Left 1140134838 16:72196909-72196931 CCAAGTGCAGTGTGACTTACATT No data
Right 1140134839 16:72196939-72196961 TTATAAGCATACAGATTCTCAGG No data
1140134838_1140134840 19 Left 1140134838 16:72196909-72196931 CCAAGTGCAGTGTGACTTACATT No data
Right 1140134840 16:72196951-72196973 AGATTCTCAGGTCTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140134838 Original CRISPR AATGTAAGTCACACTGCACT TGG (reversed) Intergenic
No off target data available for this crispr