ID: 1140134839

View in Genome Browser
Species Human (GRCh38)
Location 16:72196939-72196961
Sequence TTATAAGCATACAGATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140134838_1140134839 7 Left 1140134838 16:72196909-72196931 CCAAGTGCAGTGTGACTTACATT No data
Right 1140134839 16:72196939-72196961 TTATAAGCATACAGATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140134839 Original CRISPR TTATAAGCATACAGATTCTC AGG Intergenic
No off target data available for this crispr