ID: 1140135877

View in Genome Browser
Species Human (GRCh38)
Location 16:72205078-72205100
Sequence CAGCCTAGACACACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140135877_1140135885 21 Left 1140135877 16:72205078-72205100 CCATCCTCAGTGTGTCTAGGCTG No data
Right 1140135885 16:72205122-72205144 GGACCAGGGCCTTACAGTGCAGG No data
1140135877_1140135881 0 Left 1140135877 16:72205078-72205100 CCATCCTCAGTGTGTCTAGGCTG No data
Right 1140135881 16:72205101-72205123 TGACTCTGACTTTCTGGGCCAGG No data
1140135877_1140135880 -5 Left 1140135877 16:72205078-72205100 CCATCCTCAGTGTGTCTAGGCTG No data
Right 1140135880 16:72205096-72205118 GGCTGTGACTCTGACTTTCTGGG No data
1140135877_1140135879 -6 Left 1140135877 16:72205078-72205100 CCATCCTCAGTGTGTCTAGGCTG No data
Right 1140135879 16:72205095-72205117 AGGCTGTGACTCTGACTTTCTGG No data
1140135877_1140135882 6 Left 1140135877 16:72205078-72205100 CCATCCTCAGTGTGTCTAGGCTG No data
Right 1140135882 16:72205107-72205129 TGACTTTCTGGGCCAGGACCAGG No data
1140135877_1140135883 7 Left 1140135877 16:72205078-72205100 CCATCCTCAGTGTGTCTAGGCTG No data
Right 1140135883 16:72205108-72205130 GACTTTCTGGGCCAGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140135877 Original CRISPR CAGCCTAGACACACTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr