ID: 1140137676

View in Genome Browser
Species Human (GRCh38)
Location 16:72222213-72222235
Sequence CTTGAGAAGGTGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140137676_1140137683 11 Left 1140137676 16:72222213-72222235 CCTTCCTGCCTCACCTTCTCAAG No data
Right 1140137683 16:72222247-72222269 AAGGCACTCACCACCATGCCTGG No data
1140137676_1140137685 22 Left 1140137676 16:72222213-72222235 CCTTCCTGCCTCACCTTCTCAAG No data
Right 1140137685 16:72222258-72222280 CACCATGCCTGGCATAACCCTGG No data
1140137676_1140137682 -8 Left 1140137676 16:72222213-72222235 CCTTCCTGCCTCACCTTCTCAAG No data
Right 1140137682 16:72222228-72222250 TTCTCAAGTAGCTGGGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140137676 Original CRISPR CTTGAGAAGGTGAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr