ID: 1140137832 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:72223511-72223533 |
| Sequence | CCTTATGACCAGTCAGTGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140137829_1140137832 | 12 | Left | 1140137829 | 16:72223476-72223498 | CCTAACAGTTGTTTACAGTTGGT | No data | ||
| Right | 1140137832 | 16:72223511-72223533 | CCTTATGACCAGTCAGTGGCTGG | No data | ||||
| 1140137827_1140137832 | 13 | Left | 1140137827 | 16:72223475-72223497 | CCCTAACAGTTGTTTACAGTTGG | No data | ||
| Right | 1140137832 | 16:72223511-72223533 | CCTTATGACCAGTCAGTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140137832 | Original CRISPR | CCTTATGACCAGTCAGTGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||