ID: 1140137832

View in Genome Browser
Species Human (GRCh38)
Location 16:72223511-72223533
Sequence CCTTATGACCAGTCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140137829_1140137832 12 Left 1140137829 16:72223476-72223498 CCTAACAGTTGTTTACAGTTGGT No data
Right 1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG No data
1140137827_1140137832 13 Left 1140137827 16:72223475-72223497 CCCTAACAGTTGTTTACAGTTGG No data
Right 1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140137832 Original CRISPR CCTTATGACCAGTCAGTGGC TGG Intergenic
No off target data available for this crispr