ID: 1140139706

View in Genome Browser
Species Human (GRCh38)
Location 16:72243917-72243939
Sequence GGAATTTTAATGAGCCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140139704_1140139706 0 Left 1140139704 16:72243894-72243916 CCTGCACGAGAGTTTTCATCAGT No data
Right 1140139706 16:72243917-72243939 GGAATTTTAATGAGCCCTAAAGG No data
1140139703_1140139706 17 Left 1140139703 16:72243877-72243899 CCTGAAAGAGGGACTGACCTGCA No data
Right 1140139706 16:72243917-72243939 GGAATTTTAATGAGCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140139706 Original CRISPR GGAATTTTAATGAGCCCTAA AGG Intergenic
No off target data available for this crispr