ID: 1140145074

View in Genome Browser
Species Human (GRCh38)
Location 16:72299079-72299101
Sequence CAGGGTGAAGTGCATATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140145074_1140145082 12 Left 1140145074 16:72299079-72299101 CCTGTTATATGCACTTCACCCTG No data
Right 1140145082 16:72299114-72299136 AGTGAAAGTTGTAGGGTTCCAGG No data
1140145074_1140145081 5 Left 1140145074 16:72299079-72299101 CCTGTTATATGCACTTCACCCTG No data
Right 1140145081 16:72299107-72299129 ATTCAAAAGTGAAAGTTGTAGGG No data
1140145074_1140145080 4 Left 1140145074 16:72299079-72299101 CCTGTTATATGCACTTCACCCTG No data
Right 1140145080 16:72299106-72299128 GATTCAAAAGTGAAAGTTGTAGG No data
1140145074_1140145084 30 Left 1140145074 16:72299079-72299101 CCTGTTATATGCACTTCACCCTG No data
Right 1140145084 16:72299132-72299154 CCAGGCTTCTACAGTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140145074 Original CRISPR CAGGGTGAAGTGCATATAAC AGG (reversed) Intergenic
No off target data available for this crispr