ID: 1140145882

View in Genome Browser
Species Human (GRCh38)
Location 16:72308114-72308136
Sequence TAGATTTTGACAGACAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140145882_1140145885 0 Left 1140145882 16:72308114-72308136 CCATGCCTGTCTGTCAAAATCTA No data
Right 1140145885 16:72308137-72308159 CTCAGTCACTTGTCTGGAACTGG No data
1140145882_1140145886 28 Left 1140145882 16:72308114-72308136 CCATGCCTGTCTGTCAAAATCTA No data
Right 1140145886 16:72308165-72308187 AGTCCTTCTTTTCACTGATGAGG No data
1140145882_1140145884 -6 Left 1140145882 16:72308114-72308136 CCATGCCTGTCTGTCAAAATCTA No data
Right 1140145884 16:72308131-72308153 AATCTACTCAGTCACTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140145882 Original CRISPR TAGATTTTGACAGACAGGCA TGG (reversed) Intergenic
No off target data available for this crispr