ID: 1140151775

View in Genome Browser
Species Human (GRCh38)
Location 16:72374783-72374805
Sequence TCCAGTTACATGGCTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140151775_1140151780 26 Left 1140151775 16:72374783-72374805 CCATTTCAAGCCATGTAACTGGA No data
Right 1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG No data
1140151775_1140151778 15 Left 1140151775 16:72374783-72374805 CCATTTCAAGCCATGTAACTGGA No data
Right 1140151778 16:72374821-72374843 AGTGAGTTTAGACAGAGAAAAGG No data
1140151775_1140151779 22 Left 1140151775 16:72374783-72374805 CCATTTCAAGCCATGTAACTGGA No data
Right 1140151779 16:72374828-72374850 TTAGACAGAGAAAAGGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140151775 Original CRISPR TCCAGTTACATGGCTTGAAA TGG (reversed) Intergenic
No off target data available for this crispr