ID: 1140151777

View in Genome Browser
Species Human (GRCh38)
Location 16:72374793-72374815
Sequence AGTGATACCATCCAGTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140151777_1140151783 24 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151783 16:72374840-72374862 AAGGCCTAAGGATGGCTTTGGGG No data
1140151777_1140151779 12 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151779 16:72374828-72374850 TTAGACAGAGAAAAGGCCTAAGG No data
1140151777_1140151778 5 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151778 16:72374821-72374843 AGTGAGTTTAGACAGAGAAAAGG No data
1140151777_1140151780 16 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG No data
1140151777_1140151781 22 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151781 16:72374838-72374860 AAAAGGCCTAAGGATGGCTTTGG No data
1140151777_1140151782 23 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151782 16:72374839-72374861 AAAGGCCTAAGGATGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140151777 Original CRISPR AGTGATACCATCCAGTTACA TGG (reversed) Intergenic
No off target data available for this crispr