ID: 1140151780

View in Genome Browser
Species Human (GRCh38)
Location 16:72374832-72374854
Sequence ACAGAGAAAAGGCCTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140151775_1140151780 26 Left 1140151775 16:72374783-72374805 CCATTTCAAGCCATGTAACTGGA No data
Right 1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG No data
1140151777_1140151780 16 Left 1140151777 16:72374793-72374815 CCATGTAACTGGATGGTATCACT No data
Right 1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140151780 Original CRISPR ACAGAGAAAAGGCCTAAGGA TGG Intergenic
No off target data available for this crispr