ID: 1140152479

View in Genome Browser
Species Human (GRCh38)
Location 16:72383575-72383597
Sequence TCCAATCATACCATTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140152479_1140152484 20 Left 1140152479 16:72383575-72383597 CCAACCCCAATGGTATGATTGGA No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data
1140152479_1140152483 0 Left 1140152479 16:72383575-72383597 CCAACCCCAATGGTATGATTGGA No data
Right 1140152483 16:72383598-72383620 AATCAAAAGCAAGAGTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140152479 Original CRISPR TCCAATCATACCATTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr