ID: 1140152484

View in Genome Browser
Species Human (GRCh38)
Location 16:72383618-72383640
Sequence TGGAAATATTTACAAATATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140152482_1140152484 14 Left 1140152482 16:72383581-72383603 CCAATGGTATGATTGGAAATCAA No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data
1140152479_1140152484 20 Left 1140152479 16:72383575-72383597 CCAACCCCAATGGTATGATTGGA No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data
1140152481_1140152484 15 Left 1140152481 16:72383580-72383602 CCCAATGGTATGATTGGAAATCA No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data
1140152480_1140152484 16 Left 1140152480 16:72383579-72383601 CCCCAATGGTATGATTGGAAATC No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data
1140152476_1140152484 26 Left 1140152476 16:72383569-72383591 CCTTTCCCAACCCCAATGGTATG No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data
1140152477_1140152484 21 Left 1140152477 16:72383574-72383596 CCCAACCCCAATGGTATGATTGG No data
Right 1140152484 16:72383618-72383640 TGGAAATATTTACAAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140152484 Original CRISPR TGGAAATATTTACAAATATG TGG Intergenic
No off target data available for this crispr