ID: 1140160995

View in Genome Browser
Species Human (GRCh38)
Location 16:72494428-72494450
Sequence AGTTTTTAGACTAGGAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140160995_1140160997 2 Left 1140160995 16:72494428-72494450 CCTATGTTCCTAGTCTAAAAACT No data
Right 1140160997 16:72494453-72494475 AACTCCGTTCTCTAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140160995 Original CRISPR AGTTTTTAGACTAGGAACAT AGG (reversed) Intergenic
No off target data available for this crispr