ID: 1140160997

View in Genome Browser
Species Human (GRCh38)
Location 16:72494453-72494475
Sequence AACTCCGTTCTCTAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140160995_1140160997 2 Left 1140160995 16:72494428-72494450 CCTATGTTCCTAGTCTAAAAACT No data
Right 1140160997 16:72494453-72494475 AACTCCGTTCTCTAGAATGAAGG No data
1140160996_1140160997 -6 Left 1140160996 16:72494436-72494458 CCTAGTCTAAAAACTTTAACTCC No data
Right 1140160997 16:72494453-72494475 AACTCCGTTCTCTAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140160997 Original CRISPR AACTCCGTTCTCTAGAATGA AGG Intergenic
No off target data available for this crispr