ID: 1140171055

View in Genome Browser
Species Human (GRCh38)
Location 16:72605392-72605414
Sequence GGTACAATGTTAAATGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140171055_1140171057 -7 Left 1140171055 16:72605392-72605414 CCATTTGCATTTAACATTGTACC No data
Right 1140171057 16:72605408-72605430 TTGTACCGGAAGCTCTAGCCAGG No data
1140171055_1140171061 30 Left 1140171055 16:72605392-72605414 CCATTTGCATTTAACATTGTACC No data
Right 1140171061 16:72605445-72605467 AAATGAAGTAATATACATCTAGG No data
1140171055_1140171058 -6 Left 1140171055 16:72605392-72605414 CCATTTGCATTTAACATTGTACC No data
Right 1140171058 16:72605409-72605431 TGTACCGGAAGCTCTAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140171055 Original CRISPR GGTACAATGTTAAATGCAAA TGG (reversed) Intergenic
No off target data available for this crispr