ID: 1140174382

View in Genome Browser
Species Human (GRCh38)
Location 16:72641798-72641820
Sequence CAAACTAACTAAATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140174380_1140174382 2 Left 1140174380 16:72641773-72641795 CCAAAATGGCATATTTGACTTAT No data
Right 1140174382 16:72641798-72641820 CAAACTAACTAAATGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140174382 Original CRISPR CAAACTAACTAAATGGAGTC AGG Intergenic
No off target data available for this crispr