ID: 1140178872

View in Genome Browser
Species Human (GRCh38)
Location 16:72693986-72694008
Sequence GGGTATTCAATTACAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140178872_1140178876 8 Left 1140178872 16:72693986-72694008 CCTCTTTTTGTAATTGAATACCC No data
Right 1140178876 16:72694017-72694039 CTTCTCCTGCTTGATTGTCCTGG 0: 3
1: 75
2: 3010
3: 6288
4: 5436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140178872 Original CRISPR GGGTATTCAATTACAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr