ID: 1140184122

View in Genome Browser
Species Human (GRCh38)
Location 16:72751481-72751503
Sequence GGTCATCCACCTTGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140184122_1140184124 -9 Left 1140184122 16:72751481-72751503 CCTTCCACACAAGGTGGATGACC No data
Right 1140184124 16:72751495-72751517 TGGATGACCATTGCCTGAACTGG No data
1140184122_1140184125 -8 Left 1140184122 16:72751481-72751503 CCTTCCACACAAGGTGGATGACC No data
Right 1140184125 16:72751496-72751518 GGATGACCATTGCCTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140184122 Original CRISPR GGTCATCCACCTTGTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr