ID: 1140186464

View in Genome Browser
Species Human (GRCh38)
Location 16:72777235-72777257
Sequence AAGCCAGCCCAGAAATATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140186464_1140186467 19 Left 1140186464 16:72777235-72777257 CCCTCATATTTCTGGGCTGGCTT No data
Right 1140186467 16:72777277-72777299 GACAGTTTTCCCACTCTATGTGG No data
1140186464_1140186468 27 Left 1140186464 16:72777235-72777257 CCCTCATATTTCTGGGCTGGCTT No data
Right 1140186468 16:72777285-72777307 TCCCACTCTATGTGGCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140186464 Original CRISPR AAGCCAGCCCAGAAATATGA GGG (reversed) Intergenic
No off target data available for this crispr