ID: 1140189757

View in Genome Browser
Species Human (GRCh38)
Location 16:72805338-72805360
Sequence GTGAGCAATGCCAAGGCGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140189757_1140189761 13 Left 1140189757 16:72805338-72805360 CCTACCGCCTTGGCATTGCTCAC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1140189761 16:72805374-72805396 TCTGAAAAGCCCACTATTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140189757 Original CRISPR GTGAGCAATGCCAAGGCGGT AGG (reversed) Intronic
902764732 1:18606772-18606794 GTGGGCGATGCCAAGGCAGCTGG - Intergenic
903672777 1:25046326-25046348 GTGTCCAAAGCAAAGGCGGTGGG - Intergenic
904347688 1:29884009-29884031 ATGAGAGATGGCAAGGCGGTCGG + Intergenic
905533283 1:38699297-38699319 GTGAGCAAAGCCAGGGAAGTAGG - Intergenic
905636049 1:39553367-39553389 ATGAGCAATGCCAGGCCGGAGGG + Intergenic
908880031 1:68721247-68721269 TTGAGCAATGCCAATGCATTTGG + Intergenic
909077010 1:71061330-71061352 TAGAGCCATGACAAGGCGGTGGG - Intergenic
911117890 1:94265257-94265279 GTCAGCAATGCCAAGGCAGAAGG - Intronic
915523258 1:156460853-156460875 GGGAGCAAGGCCAAGGAGTTAGG + Intergenic
915631548 1:157156577-157156599 GTGAGCACAGGCAAGGCGGAAGG - Intergenic
919782631 1:201230707-201230729 ATGAGCAAAGGCAAGGAGGTAGG + Intergenic
921730856 1:218576503-218576525 GAGAGAAATGCCTAGGTGGTTGG + Intergenic
923425603 1:233865799-233865821 GTGAGCAAGGAAAAGGAGGTAGG - Intergenic
1064376356 10:14800065-14800087 GGGACCAATGGCAAGGAGGTTGG + Intergenic
1064376470 10:14800992-14801014 GGGACCAATGGCAAGGAGGTTGG - Intergenic
1064857124 10:19781763-19781785 GATAGCAATGGGAAGGCGGTGGG - Intronic
1065943140 10:30583167-30583189 GGGAGCAATGCCAAGGTTGGAGG - Intergenic
1066242183 10:33549071-33549093 GTGAACAGTGACAAGGAGGTTGG - Intergenic
1069981462 10:72255543-72255565 GTGAGCAGTGCCAGGGAGGGAGG - Intergenic
1070372812 10:75801299-75801321 GTCAGGGATGCCAAAGCGGTTGG - Intronic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1073896522 10:108166604-108166626 GTTGGCAATGCCAAGGCCATCGG + Intergenic
1078511870 11:11990616-11990638 GAGAGCCATGCCAAGGAGTTAGG - Intronic
1079121418 11:17688011-17688033 GTGAGCAGTGAGCAGGCGGTGGG - Intergenic
1080462448 11:32467293-32467315 CTTAGGAATGCCAAGGCGGGTGG + Intergenic
1086384556 11:86293721-86293743 TTGGGCAAAGCCAAGGCGGGTGG + Intergenic
1092511363 12:9160328-9160350 GAGATCAAGGCCAAGGCCGTTGG - Exonic
1094347180 12:29483688-29483710 ATAAGCAATGTCAAGGAGGTGGG - Intronic
1094849582 12:34376412-34376434 GGGTGCCAGGCCAAGGCGGTAGG - Intergenic
1096717486 12:53499939-53499961 GGGAGCAATGCCAGAGCGCTAGG - Intronic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1098243223 12:68488849-68488871 TTGGGCAATGCCAAGGGAGTTGG + Intergenic
1099805829 12:87517794-87517816 CTCAGCAATGCCATGGGGGTGGG - Intergenic
1100020395 12:90062428-90062450 CTTTGCAATGCCAAGGCGGACGG + Intergenic
1109724785 13:66326065-66326087 GTGAGTAAAAACAAGGCGGTTGG - Intronic
1109862131 13:68213676-68213698 GTGAGAAATGCTAAGGTTGTAGG - Intergenic
1110203886 13:72887971-72887993 TTGAGCAATACCAACACGGTCGG - Intronic
1112760396 13:102688515-102688537 GTGTGGAAGGCCAGGGCGGTGGG + Intronic
1113770897 13:112908157-112908179 GTGTCCAATGCCAAGGGTGTGGG + Intronic
1118298785 14:64595458-64595480 GTGAGCCATGCCAAGAGGCTTGG + Intergenic
1118342983 14:64911529-64911551 GTGAACCATGCCAAGGAGTTTGG - Intergenic
1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG + Intergenic
1121737854 14:96231129-96231151 GTGAGCAAAGCCAGGCCGGCAGG + Intronic
1122129159 14:99595109-99595131 GTGAGCAAGGCCAGGGCCGGTGG - Intronic
1123873257 15:24597445-24597467 GAGACCACTGCCAAGGGGGTGGG + Intergenic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1135947176 16:26875415-26875437 GTGAGCATTGCCAAGGAAGAAGG - Intergenic
1136127338 16:28193686-28193708 GTGAGCAAGGCCAAGGTTATTGG - Intronic
1136748826 16:32615189-32615211 CAGGGCAATGCCAAGGCAGTGGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1203050959 16_KI270728v1_random:874403-874425 CAGGGCAATGCCAAGGCAGTGGG - Intergenic
1143301370 17:5913020-5913042 GTGATGGATGCCTAGGCGGTAGG + Intronic
1146622375 17:34409061-34409083 GTGAACCATGCCAAGGGGCTTGG + Intergenic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1151444914 17:74157081-74157103 AAGAGCAATGCCAATGGGGTAGG + Intergenic
1151764550 17:76125442-76125464 GTGAGCAAAGGCATGGAGGTGGG - Intergenic
1152089017 17:78236830-78236852 GTGACCAATACCAAGGCTGCTGG - Intronic
1152257169 17:79246843-79246865 GTGAGCAGTGCCAATGGGATGGG + Intronic
1152562713 17:81086612-81086634 GTGAGCAGTCCCAAGGTGGCAGG - Intronic
1156484048 18:37453621-37453643 AGGAGCAATGGCAAGGAGGTGGG + Intronic
1158069671 18:53456077-53456099 GTGATCAATGCCAAGGTGAGTGG + Intronic
1158665489 18:59429071-59429093 GCGAGGAATGCCAAGACTGTGGG + Intergenic
1158992983 18:62889234-62889256 GGGAGGAATGCAAAGGGGGTGGG + Intronic
1159512238 18:69410280-69410302 GTGAGGAACGCCCAGGCGGAAGG - Intronic
1163348783 19:16762177-16762199 GTGAGCAATGCCAGGCAGGGTGG - Intronic
1166511243 19:43410358-43410380 GTGAGCAAAGCCAAAGAGGCTGG + Intronic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
927823220 2:26287678-26287700 GTGAGCAATACCAACATGGTTGG + Intronic
931586421 2:63834763-63834785 CTGAGCACAGCCAAGGAGGTAGG - Intergenic
934860521 2:97760622-97760644 GTGTGAAATGCCAAGGCTGCTGG + Exonic
935272815 2:101449678-101449700 GGGAGGAATGCCTAGGAGGTGGG + Intronic
948122743 2:235543293-235543315 GTGAGAAATGCCTAGTCGGAAGG + Intronic
1175175294 20:57108211-57108233 GTGAGAAATGCCATGGTGGCTGG - Intergenic
1179502057 21:41816089-41816111 GCGAGCAACGCCGGGGCGGTGGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180701802 22:17785258-17785280 GTCAGCAGTCCCAAGTCGGTGGG + Intergenic
949362231 3:3244147-3244169 GTCAGCAATGCCATGGCACTGGG + Intergenic
953878733 3:46680798-46680820 GTGTGCAAAGCCATGGAGGTAGG + Intronic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
954711896 3:52509304-52509326 GAGAGCAATGCCAGGAAGGTGGG + Exonic
955353227 3:58209470-58209492 GATAGCAATGCCAAGCCTGTGGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
959322082 3:104889464-104889486 ATGAGAAATTCCAAGGCTGTTGG - Intergenic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
965565816 3:170116649-170116671 GTGAGCCATGGCATGGCGCTCGG - Intronic
967935309 3:194722920-194722942 GTGAGTAATTCAAAGACGGTTGG + Intergenic
969695068 4:8729633-8729655 GTGACCACTGCCAAGGCCATGGG + Intergenic
972001576 4:34042333-34042355 GTGAGTAATGACAAAGCGTTGGG - Intergenic
973319386 4:48794720-48794742 GTGAGGGAGGCCAAGGCGGGTGG - Intergenic
973370542 4:49243619-49243641 GTGACCAAGGCCCAGGAGGTGGG + Intergenic
973390482 4:49551797-49551819 GTGACCAAGGCCCAGGAGGTGGG - Intergenic
974711688 4:65605412-65605434 GAGAGCAATGCCAACAAGGTAGG - Intronic
977224279 4:94375850-94375872 GTCAGGAATGCAAAGGCAGTGGG - Intergenic
980704885 4:136480195-136480217 TTAAACAATGCCAAGGCAGTAGG - Intergenic
981095714 4:140777715-140777737 GTGAGGCATGCCAATGAGGTAGG - Intergenic
986335366 5:6751120-6751142 CTGGGCATTGGCAAGGCGGTGGG - Exonic
988531436 5:32030819-32030841 ATGAGAAATACCAAGGGGGTGGG - Intronic
990175543 5:53103885-53103907 GTGGCCAATGCCAAGGCACTGGG + Intronic
992067271 5:73120077-73120099 GTGGCCAAGGCCAAGGCGGCCGG + Intergenic
1001990707 5:176113565-176113587 CAGGGCAATGCCAAGGCAGTGGG - Intronic
1002226166 5:177724575-177724597 CAGGGCAATGCCAAGGCAGTGGG + Intronic
1002267684 5:178046638-178046660 CAGGGCAATGCCAAGGCAGTGGG - Intronic
1004557871 6:16717223-16717245 GTAGGCAATGCCAAGGTTGTTGG + Intronic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1015877170 6:137834396-137834418 GTTTGGAATGCCAAGGCGGGCGG - Intergenic
1016845032 6:148561289-148561311 GTGACCAGTGCCAAAACGGTTGG + Intergenic
1019767553 7:2863015-2863037 GCGAGCACTGCCAAGGCGACCGG - Intergenic
1023119989 7:36899452-36899474 ATGAGCAAAGGCAAGGAGGTAGG + Intronic
1025785793 7:64642345-64642367 GTGAGCAGTGCCAAAGCAGGAGG - Intergenic
1028745027 7:94318128-94318150 GTAGGCAATGCCAAGGAGGTGGG - Intergenic
1029157584 7:98528302-98528324 CTAAGGAATGCCAAGGCGGCCGG - Intergenic
1030226647 7:107159203-107159225 ATGAGCAATGCTAAGTTGGTGGG - Intronic
1030857917 7:114584684-114584706 GTGGGCAAAGCCATGGTGGTGGG - Intronic
1034985640 7:155512459-155512481 GTGAGCAATGGAATGGGGGTGGG + Intronic
1035266351 7:157692154-157692176 GGGAACAATGGCCAGGCGGTGGG - Intronic
1036062698 8:5342118-5342140 GTGAGGAATACCAAGTAGGTAGG - Intergenic
1039799260 8:40940093-40940115 GTGAGCAAAGACATGGAGGTTGG + Intergenic
1041820982 8:62032706-62032728 GTGAGAAATGCACAGGAGGTCGG - Intergenic
1042669632 8:71247102-71247124 GTGAGCTGTGCCAAGAGGGTGGG - Intronic
1049460552 8:142725711-142725733 GTGAGCAATGCTAGGGTGTTGGG + Intergenic
1049573567 8:143380499-143380521 GTGGGCAACGCCAGGGCTGTGGG - Intronic
1051516133 9:17932273-17932295 GTTGGCAATTCCAGGGCGGTTGG + Intergenic
1056721841 9:89078727-89078749 GTGAGAAATGCCTGGGAGGTGGG + Intronic
1058312421 9:103520293-103520315 TTGAGCCATGCCAAGGCTCTTGG + Intergenic
1059422584 9:114201455-114201477 GCGAGCATAGCCAAGGCGGGAGG - Intronic
1061029445 9:128071038-128071060 GGCAGCAATGCCAAGTGGGTAGG - Intronic
1197744849 X:129925196-129925218 GTGAGCAGAGCCAGGGTGGTGGG + Intronic