ID: 1140190496

View in Genome Browser
Species Human (GRCh38)
Location 16:72811819-72811841
Sequence ACTTTTGGGTGGGCGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140190496 Original CRISPR ACTTTTGGGTGGGCGGGCTT GGG (reversed) Intronic
900095351 1:937948-937970 GCTTGTGGGGGGACGGGCTTGGG + Intronic
900802242 1:4744660-4744682 ACATGAGGGTGGGCGTGCTTGGG - Intronic
903963472 1:27071687-27071709 TCTTTTGAGGGGGAGGGCTTTGG - Intergenic
907896513 1:58697877-58697899 ACTTTTGGGTTGGCTGGGTGCGG - Intronic
908442011 1:64164250-64164272 ACTTTTGGGTGGCAGGATTTTGG - Intronic
910609775 1:89128352-89128374 AGTTCCGGGTGGGCGGGCGTGGG - Intronic
911182800 1:94876055-94876077 ACCTGTGGGTGGGAGGGCATAGG - Intronic
915043164 1:152985366-152985388 ACTTTGGGGTGGCAGGGCTCAGG - Exonic
915047705 1:153032481-153032503 ACTTTGGGGTGGCAGGGCTCAGG - Exonic
915971587 1:160358787-160358809 ACATTAGGGTGGGCGTGCTGCGG + Exonic
917072767 1:171170244-171170266 ACTTTTGGGGGGGAGGGGTGTGG - Intergenic
922767362 1:228163003-228163025 TCTTTGGGGTGGGGGGGCCTAGG + Intergenic
923371521 1:233318891-233318913 ACTTCTGGGTGGGTAGGATTAGG - Intergenic
1065842437 10:29714019-29714041 AGTGTTGGGTGGGAAGGCTTGGG + Intronic
1078300840 11:10130689-10130711 ATTTTTGTGGGGGCGGGGTTGGG - Intronic
1079545451 11:21627503-21627525 ACTTCAGGGTGGGCTGGTTTGGG + Intergenic
1079687939 11:23384858-23384880 ACTTTTGGGTGGTAGAGATTAGG - Intergenic
1080778741 11:35410793-35410815 CCTTGTGGGTGGGCAGGCTTTGG + Intronic
1084465471 11:69320638-69320660 ACTTTTGGGGAGGCAGGCTGGGG - Intronic
1088678781 11:112221781-112221803 TTTTTTTGGTGGGGGGGCTTGGG + Intronic
1091784026 12:3231550-3231572 TCTTTAGGGTGGGCTGGCATGGG - Intronic
1094511165 12:31097284-31097306 ACTGTGGGGTAGGTGGGCTTTGG + Intronic
1096478111 12:51921028-51921050 ATTTTTGGCTGGGTGGGCTGGGG - Exonic
1103063797 12:117880455-117880477 TCTCTTTGGTGGGGGGGCTTGGG - Intronic
1104601669 12:130158410-130158432 ACTTTAGGATGGGGGTGCTTCGG + Intergenic
1105250593 13:18695927-18695949 ACTTTTGGATGAGAGGGCGTGGG - Intergenic
1113127261 13:106993131-106993153 ACTTTTGGGTGGTAGGGGTGAGG + Intergenic
1127001008 15:54505233-54505255 ACTTCTGGGTGTGTGAGCTTAGG - Intronic
1127763705 15:62164914-62164936 ACTTTGGCGAAGGCGGGCTTCGG + Exonic
1131800504 15:96064390-96064412 ACTTTTGGTGGGGGGGCCTTTGG - Intergenic
1132311755 15:100862417-100862439 TCTTGGGGGTGGGCGGGCTGTGG + Intergenic
1135646417 16:24166377-24166399 ACGTTTGGGTGGATGGTCTTAGG + Intronic
1140190496 16:72811819-72811841 ACTTTTGGGTGGGCGGGCTTGGG - Intronic
1141790689 16:86232279-86232301 ACTTTTGTGTGGGAGGCCGTTGG + Intergenic
1142352538 16:89586774-89586796 TCTTGTGGGTGGGGAGGCTTCGG - Intronic
1144659140 17:17057158-17057180 ACTGCTGGGTGGGAGGGCTATGG + Intronic
1149588052 17:57806776-57806798 ACTTAAGGGTGGGTGGGATTTGG + Intergenic
1149753953 17:59172577-59172599 AGTTCTGGGTGGGCGTGGTTTGG + Intronic
1151341358 17:73473070-73473092 GCTTTTGGGCTGGCGGGGTTGGG + Intronic
1155069218 18:22298601-22298623 ATTCTTGGGAGGGCGTGCTTGGG + Intergenic
1161091059 19:2360240-2360262 ACTTCGGGGTGGGCGGGATCCGG + Intergenic
1161850923 19:6737614-6737636 GCTCATCGGTGGGCGGGCTTGGG - Intergenic
1165952771 19:39483381-39483403 AGCCTTGGGTGGGAGGGCTTGGG + Intronic
932193219 2:69758720-69758742 ACTTATGGGTGGTTGGGCTTTGG + Intronic
939617488 2:144377551-144377573 ACTCATGGGTGGGCGGGCAGTGG + Intergenic
940251305 2:151679663-151679685 AAATGTGGGTGGGTGGGCTTGGG - Intronic
1170871296 20:20208931-20208953 TCTTTGGGGTGGGGGGGCATGGG + Intronic
1174313163 20:49675245-49675267 ACTGTGGGGTGTGTGGGCTTGGG - Intronic
1175182027 20:57155451-57155473 CCTTTGGGGTGGGCTGTCTTGGG + Intergenic
1176457423 21:6926473-6926495 ACTTTTGGATGAGAGGGCGTAGG - Intergenic
1176835596 21:13791557-13791579 ACTTTTGGATGAGAGGGCGTAGG - Intergenic
1181471122 22:23140672-23140694 ACTATTGTGTGGGAGGGCTCTGG - Intronic
1183549666 22:38474459-38474481 TCTTGAGGGTGGGCAGGCTTGGG + Intronic
955366798 3:58317639-58317661 ACCTTTGGTGGGGTGGGCTTCGG + Exonic
963648868 3:147951319-147951341 ATTTTTGGGTGAGTGGGCTGAGG + Intergenic
967971803 3:195004832-195004854 GCATTTGGGTGGGAGGGCCTGGG - Intergenic
995882817 5:116861805-116861827 ATTTTTGTGTGGGCAGGCTCAGG + Intergenic
995968085 5:117933785-117933807 ACTATTGGGTGGGTGGGGTGAGG - Intergenic
1001559764 5:172661400-172661422 ACTTTTGGGTTGGCGGGGCGTGG - Intronic
1006134164 6:31885754-31885776 ACTTTTGAGTGGGCAGACTTAGG - Intronic
1006408325 6:33857768-33857790 ACCTTGGGGTGGGCGGCCTGGGG - Intergenic
1008625058 6:53307246-53307268 ACTTTTGGGTGGTAGTGGTTAGG + Intronic
1010650521 6:78449368-78449390 ACTTATTGGTGGGTGGGCTGGGG + Intergenic
1012817474 6:104042187-104042209 CCTTTTGGGTGGGATTGCTTTGG - Intergenic
1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG + Intronic
1017602064 6:156094533-156094555 ACTTTTTGGTGGCCGGGCTGTGG - Intergenic
1022078088 7:26993150-26993172 CCTTTTGGGTGGGCAGCCTGGGG + Intronic
1031614464 7:123864683-123864705 ACTTTTGGAAGGGCAGGCTTGGG + Intronic
1034984706 7:155501984-155502006 AGTTTTGGGTCGGGGGGGTTGGG + Exonic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037583739 8:20262166-20262188 ACACTTGGCTGGGTGGGCTTGGG - Intronic
1038836802 8:31135012-31135034 TTTTTTTGGTGGGGGGGCTTGGG - Intronic
1044678331 8:94751863-94751885 ACTTTTTGGTGGTGGGGCTCCGG + Intronic
1045773112 8:105768617-105768639 ACTTTGGAGTGGGCAGACTTGGG + Intronic
1048878725 8:138856740-138856762 GCTTTTGTGTGGGCGGCCTGTGG + Intronic
1052425390 9:28297901-28297923 ACTTTTGTGTGTGCGGGGGTAGG + Intronic
1052623445 9:30943969-30943991 AGTGTAGGGTGGGCGGGCTGAGG + Intergenic
1054821225 9:69522299-69522321 ACTATTGGGTGGGAGGGGTGGGG - Intronic
1060791637 9:126489293-126489315 ACTTTGGGGTGAGGGGGCCTGGG - Intronic
1061791394 9:133061030-133061052 ACTGTTGGGTGGGAAGGCTCTGG + Intergenic
1061795072 9:133081597-133081619 ACTGTTGGGTGGGAAGGCTCTGG + Intronic
1061933468 9:133845147-133845169 AGTTTTGGGTGGGCGGACATGGG + Intronic
1189473936 X:41334669-41334691 CCTTTTGGCTTGGAGGGCTTCGG + Intronic
1190369481 X:49727247-49727269 ACTTCTGGGTGGAAGGGGTTGGG + Intergenic
1190756471 X:53405917-53405939 TCTTTTGTGTGGGCTGGCATAGG + Exonic
1193318922 X:80097468-80097490 CCTGTTGGGTGGGGGGGCTGGGG + Intergenic
1194918959 X:99740485-99740507 ATGTTTGGGTGGGCAGGATTGGG + Intergenic
1196783119 X:119400051-119400073 ACTTTTGCTTAGGCTGGCTTAGG + Intronic
1201252195 Y:12070543-12070565 ACTATTGGGTGTGGGGGGTTGGG - Intergenic