ID: 1140190841

View in Genome Browser
Species Human (GRCh38)
Location 16:72814758-72814780
Sequence GCAGCATTTCATGTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140190841_1140190843 1 Left 1140190841 16:72814758-72814780 CCTGCTTTAACATGAAATGCTGC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1140190843 16:72814782-72814804 TCCACTGGTGCACAAACTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 106
1140190841_1140190845 22 Left 1140190841 16:72814758-72814780 CCTGCTTTAACATGAAATGCTGC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1140190845 16:72814803-72814825 GGTTCATCTAGTTTCTATCTAGG 0: 1
1: 0
2: 0
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140190841 Original CRISPR GCAGCATTTCATGTTAAAGC AGG (reversed) Intronic
905412228 1:37778578-37778600 GCAGCAGTTGGTGTCAAAGCAGG + Intergenic
907871135 1:58444417-58444439 ACAGCCTTTCATGTCAGAGCTGG + Intronic
909853827 1:80503448-80503470 TAAGCATTTCTTGTCAAAGCAGG + Intergenic
911490306 1:98556945-98556967 GCAACATTACATGTTACACCAGG - Intergenic
914404149 1:147354137-147354159 GCAACATTTTATGTTACAACTGG + Intergenic
922236966 1:223729285-223729307 TCAGCATTTTATTTTAAAACAGG + Intronic
924432386 1:244008037-244008059 GCAGGGTTTCATCTTCAAGCCGG + Intergenic
1065989522 10:30993915-30993937 ACAGCATTACATCTTACAGCTGG - Intronic
1069077583 10:64054130-64054152 GCAACATTTCCTCTTAAAACAGG + Intergenic
1071700813 10:87933117-87933139 GCAGCAATTCACTGTAAAGCTGG + Exonic
1071733235 10:88269733-88269755 GCAGCACTACAAGTTAAAGAAGG - Intergenic
1080866101 11:36196580-36196602 GCATCATTCCAGGTTAAAGCAGG - Intronic
1081288003 11:41296224-41296246 CCAGGATTTCTTGTGAAAGCAGG - Intronic
1084031653 11:66484767-66484789 GAAGCATCACATGTTAGAGCCGG - Intronic
1091317351 11:134623936-134623958 GCAGCATTCCAGGTAAGAGCTGG - Intergenic
1092871073 12:12806266-12806288 GCAGCGATTTATGATAAAGCTGG - Intronic
1093654399 12:21677819-21677841 ACATCATTTCATGTTGAAACCGG - Intronic
1096277419 12:50221815-50221837 ACACAATTTCATGTTAAATCAGG - Intronic
1098896486 12:76068351-76068373 TCAGCTTTTCATTTTTAAGCCGG - Intronic
1104126919 12:125856386-125856408 GTGGCATTTCATGTTAATCCTGG + Intergenic
1115737223 14:36346013-36346035 GCTGCATTTTATATTACAGCAGG + Intergenic
1118887105 14:69876808-69876830 GCAGCATTTGATGTTAGGGATGG + Intronic
1119370045 14:74131877-74131899 TCATCATAGCATGTTAAAGCTGG + Intronic
1119986121 14:79139829-79139851 GCAGCATTTAATTTTAAAGGTGG - Intronic
1120548402 14:85839272-85839294 GCACCCCTTCATGTTAAAGGAGG - Intergenic
1120549971 14:85858450-85858472 GCAGCATCTCATTTTAAGGGAGG + Intergenic
1124345810 15:28920681-28920703 GCAGCCGTGGATGTTAAAGCTGG + Intronic
1126508179 15:49432849-49432871 GCATCATTTCTTGTTACAGGAGG - Intronic
1128856139 15:71018090-71018112 GGATCATTTCATGTTAGAACAGG - Intronic
1128885399 15:71282281-71282303 GCAGCATTTCCTGTGACTGCTGG - Intronic
1130825635 15:87542936-87542958 AAAGCATTTCATGTAAAACCTGG - Intergenic
1132020423 15:98356615-98356637 GCAACCATTCATGTTAAAACAGG + Intergenic
1132917641 16:2361179-2361201 GAAGGATTTCATCTTAAAGTTGG + Intergenic
1139317286 16:66084187-66084209 GAAGGATTTCATTTTAATGCAGG + Intergenic
1140190841 16:72814758-72814780 GCAGCATTTCATGTTAAAGCAGG - Intronic
1146634910 17:34496701-34496723 GGAGGATTTCATCTCAAAGCAGG - Intergenic
1150872281 17:68925786-68925808 GCATTATTTCATGGTAAATCTGG - Intronic
1153193607 18:2569755-2569777 GCAGCATCTCTTGATAAAGGTGG - Intronic
1157011769 18:43658031-43658053 GTCGCATTTCATCTGAAAGCAGG + Intergenic
1159306564 18:66650817-66650839 GCTTGATTTCATGGTAAAGCAGG - Intergenic
1163957232 19:20654899-20654921 TCAGCAGTTCAAGTTCAAGCTGG + Intronic
1165731869 19:38151110-38151132 GCAGCTTATGATGTTAAATCTGG + Intronic
1166646347 19:44534541-44534563 GCAGGATTCAATGCTAAAGCAGG + Intergenic
925483141 2:4298684-4298706 GCATCATTTCTTTGTAAAGCTGG - Intergenic
925710003 2:6729849-6729871 GCAACACTTCCTTTTAAAGCGGG - Intergenic
930929702 2:56866648-56866670 GAAGCATTTCCTTTTAAAACTGG + Intergenic
936483258 2:112905380-112905402 ACAGCATTTTATGATAATGCAGG + Intergenic
937777726 2:125799731-125799753 GCAGCATTTCATTTTTAAAAGGG + Intergenic
938170806 2:129074418-129074440 GCATCATTTCATTTGAAGGCAGG - Intergenic
940355898 2:152740406-152740428 ACACCATTTCATATTAAAACTGG - Intronic
944249237 2:197564568-197564590 GAAGCATTTCATTTGAAAACTGG - Intergenic
947336157 2:229086360-229086382 GCAGCAGTTTATTATAAAGCAGG - Intronic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
1172431001 20:34891712-34891734 GGAGGATTTCATGTTTAAGGTGG + Intronic
1172828507 20:37811394-37811416 GCAGCAGTTTATGTTAAATAAGG + Intronic
1172867158 20:38109078-38109100 GCAGCTGTTCATGTTAAACATGG - Intronic
1174548927 20:51347106-51347128 GCAGCTGCTGATGTTAAAGCAGG + Intergenic
1174596805 20:51690482-51690504 GCTGCAATTCATGTGAACGCTGG - Intronic
1178884276 21:36473117-36473139 GCAGAATTTCATTTTATAGATGG + Intronic
1179254760 21:39705899-39705921 TCAGCATTTCATGTGATATCAGG - Intergenic
1182988587 22:34744339-34744361 AAAGGTTTTCATGTTAAAGCAGG - Intergenic
949772531 3:7594663-7594685 GAAGCATTTCAGATCAAAGCAGG + Intronic
951340685 3:21483009-21483031 ACAAGATTACATGTTAAAGCTGG - Intronic
953206573 3:40835732-40835754 GCAGCATTTCATTGTAAAAGTGG - Intergenic
955152617 3:56383066-56383088 GCAGTATTTGATGATAAAGCTGG - Intronic
955815788 3:62841417-62841439 AAAGTATTTCATATTAAAGCTGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956570972 3:70694576-70694598 GAAGCAATTCATGTTAAAAGTGG + Intergenic
956571114 3:70696307-70696329 GAAGCATCTCATGTTAAAAGTGG - Intergenic
958972326 3:100625604-100625626 GCAGCATTTCCTTTGAAAACTGG - Intronic
959107168 3:102077656-102077678 ACAGCAAGTCATTTTAAAGCAGG - Intergenic
960159737 3:114337606-114337628 GCAGCAATTCAAATTACAGCAGG + Intergenic
961336521 3:126183456-126183478 GCTGCATTTCATGGAAAAGAAGG + Intronic
964648274 3:158982370-158982392 TCAGCATTTTATGGTAAAGTAGG + Intronic
967802309 3:193676310-193676332 GCATCTTTTCATGGTAAATCTGG + Intronic
969511448 4:7620362-7620384 GCAGGATGTCTTGTGAAAGCTGG - Intronic
970809333 4:20073224-20073246 GGAACTTTTCATGCTAAAGCTGG - Intergenic
973042868 4:45494683-45494705 GAAGCAGTTGATGTTAAAACAGG + Intergenic
974377276 4:61095013-61095035 CCTGCATTTCCTGTTAGAGCAGG - Intergenic
975660505 4:76684091-76684113 GCAGCATTTAAAGTGAAAGAAGG - Intronic
976819433 4:89188455-89188477 GAAGCATTTCCTGTAAAAACTGG - Intergenic
980014438 4:127632722-127632744 GCAGCATAACCTGTTAAAACAGG - Intronic
980505119 4:133709194-133709216 GCATCATCTCATGCCAAAGCTGG - Intergenic
980637441 4:135526377-135526399 GAAGCATTTCATTTGAAAACCGG + Intergenic
985124365 4:186677391-186677413 GCAAGATTTGATGTTAAACCTGG + Intronic
986798348 5:11234034-11234056 GCAGCAGTTCATGTTATTGATGG - Intronic
988161674 5:27525425-27525447 ACAGTATTTCATGGTAAAGAGGG + Intergenic
995136166 5:108682434-108682456 GAAGCATTTCATATTAAAAAAGG - Intergenic
999482358 5:151960276-151960298 ACAGGATTTGATGTTAAATCTGG + Intergenic
1002846753 6:953435-953457 TCAGCAATGAATGTTAAAGCAGG - Intergenic
1005019374 6:21402959-21402981 TCTACATTTCATCTTAAAGCTGG + Intergenic
1005624237 6:27648286-27648308 GCAGCATTTCAGAGTAAAGCAGG + Intergenic
1005747555 6:28852833-28852855 GAAGCATTCCCTTTTAAAGCTGG + Intergenic
1006255141 6:32826693-32826715 GCAGCTAATCATGATAAAGCTGG - Intronic
1009679759 6:66876776-66876798 TCAGCTATTCATGTTTAAGCAGG - Intergenic
1011517841 6:88171562-88171584 GCTGCATTTCAAGGAAAAGCTGG - Intergenic
1012374711 6:98547571-98547593 GCAGCATTTCAGAGTAAACCAGG + Intergenic
1013001348 6:106025770-106025792 GCAGCATTTCCTGATAAAATTGG + Intergenic
1015831451 6:137373713-137373735 CCAGGTTTTCATGTTAAATCAGG - Intergenic
1016913562 6:149223399-149223421 GAATCATTTCATGTCAGAGCTGG - Intronic
1018164505 6:161080488-161080510 GCACCATTTCAAGCTAAAGTAGG + Intronic
1023169062 7:37373103-37373125 TCAGCATTTCATGGTGCAGCAGG + Intronic
1023670084 7:42567032-42567054 GCAGCATATTATTTTAAAGAGGG - Intergenic
1032872224 7:135998448-135998470 GCCTCATTTGATGTAAAAGCAGG - Intergenic
1041608951 8:59821014-59821036 GCAGCTTTTCCTGATAACGCTGG + Intergenic
1041699877 8:60776480-60776502 GCAGGATTTGTTGTTCAAGCTGG + Intronic
1044839117 8:96323070-96323092 GAAACATTACATCTTAAAGCTGG + Intronic
1045653208 8:104361995-104362017 GTAGAATTTCATGTTATAGCTGG - Intronic
1046860873 8:119090085-119090107 GCAGCATTTTTTTTTTAAGCTGG + Intronic
1048173750 8:132133115-132133137 TGAGAATTTCATGTAAAAGCTGG + Intronic
1048451180 8:134535127-134535149 CCAGCATTTCACATTAAACCTGG - Intronic
1048525298 8:135196965-135196987 GCAGCATTTCATTTTCATGGTGG + Intergenic
1050365757 9:4872316-4872338 GCAGCACTTTATATCAAAGCAGG - Intronic
1052888728 9:33676272-33676294 GCAGCAATTCACTGTAAAGCTGG - Intergenic
1053316102 9:37052983-37053005 GAGGCATTGAATGTTAAAGCTGG - Intergenic
1053399252 9:37802521-37802543 GCAGCATATCATGTTACAGGAGG + Intronic
1054925782 9:70587556-70587578 GCAGCATTTCATGCCAAGGCCGG - Intronic
1055440189 9:76329477-76329499 GAAACATTTCATATTAAAGGAGG - Intronic
1186130857 X:6463806-6463828 GCAACATTACATGTTAAGGATGG - Intergenic
1186285644 X:8041332-8041354 GCAGCATTTCACATAGAAGCAGG - Intergenic
1187956570 X:24524485-24524507 ACTCCATTTCATGTTAAGGCTGG + Intronic
1189206277 X:39241849-39241871 GCAGCATTTCTTGATAATTCTGG - Intergenic
1189254053 X:39623762-39623784 GCAACATTAAATCTTAAAGCTGG + Intergenic
1195752655 X:108173972-108173994 CCAGCATTTCATGTTGAGCCTGG - Intronic
1197633691 X:128890908-128890930 GCACCATTTCCTGTTTAACCAGG - Intergenic
1198779813 X:140222219-140222241 GCAGCATGTCATGGGGAAGCAGG - Intergenic
1199858616 X:151780124-151780146 CCAGCTTTTCATGTTACAGAGGG + Intergenic
1201541316 Y:15108197-15108219 GAAGCATTCCATGTGAAAACTGG - Intergenic
1201595593 Y:15664849-15664871 GAAGCATTCCCTTTTAAAGCTGG - Intergenic