ID: 1140192533

View in Genome Browser
Species Human (GRCh38)
Location 16:72830053-72830075
Sequence CTGGGTAAACAGTTGGTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140192533 Original CRISPR CTGGGTAAACAGTTGGTATG AGG Intronic
903263795 1:22144496-22144518 CTCAGTAAACATTTGGTATTGGG + Intergenic
906956207 1:50377011-50377033 TTGGGGAAACAGTTGGTGTTTGG - Intergenic
907970690 1:59377989-59378011 CTTTGTAACCAGTTGGCATGTGG + Intronic
908668112 1:66514906-66514928 TTGGGGAAACAGGTGGTATTTGG - Intergenic
908794509 1:67817713-67817735 CTTAGTAAACAGTTGGTGTTTGG + Intronic
909473681 1:76058069-76058091 CTGAGTAAACAGTTCTTATAAGG + Intergenic
914203517 1:145506464-145506486 CTATGTAAATAGTTGTTATGTGG + Intergenic
914377887 1:147089124-147089146 CTGGGGGAACAGGTGGTATTTGG - Intergenic
914482639 1:148079618-148079640 CTATGTAAATAGTTGTTATGTGG + Intergenic
915338526 1:155162789-155162811 CTGGGTTAAGAGTTACTATGGGG - Intergenic
915835161 1:159171020-159171042 CTGGGTACACTGTTGATAGGGGG + Intergenic
917401464 1:174653588-174653610 CTGGTTAGACAGTGGGTACGGGG - Intronic
918073231 1:181149111-181149133 CTGGGCAAATGGTTGGTTTGGGG + Intergenic
921124004 1:212160925-212160947 TAGGGTAAAAAGTTGGTAGGGGG - Intergenic
923176244 1:231468554-231468576 GTGGGTACACACTTGCTATGTGG + Intergenic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
1067303904 10:45040548-45040570 TTGGGGAAACAGGTGGTATTTGG - Intergenic
1067414389 10:46092429-46092451 CTGGGTACCCAGATGGCATGAGG + Intergenic
1071177736 10:82945845-82945867 CTGGGTACAGAGTTTGGATGTGG + Intronic
1071679886 10:87694472-87694494 CTTGGAGAACAGGTGGTATGTGG + Intronic
1072868339 10:99088232-99088254 TTGGGGAAACAGGTGGTATTTGG + Intronic
1073319192 10:102603986-102604008 CTGGGGAAACAGCTGGGCTGTGG + Intronic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1086055393 11:82640408-82640430 ATGTGTAGACATTTGGTATGAGG + Intergenic
1087223344 11:95570017-95570039 ATGGCTAAACAGTTAGGATGTGG - Intergenic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1097021985 12:56027105-56027127 CTGGGACAACAGCAGGTATGGGG + Intronic
1097720867 12:63019785-63019807 CTGGGCAAACGGATGGTATAGGG + Intergenic
1098787165 12:74774362-74774384 TGGGGTAATCAGTTGGTAGGGGG - Intergenic
1099527083 12:83729096-83729118 TTGGGGGAACAGTTGGTATTTGG + Intergenic
1104701179 12:130905294-130905316 CTGGGCACACAGCTGGTAAGAGG - Intergenic
1106041144 13:26095042-26095064 CTGGGTCCACAGTTGCTTTGTGG + Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1109122088 13:58470581-58470603 TTGGGAAAACAGGTGGTATTTGG - Intergenic
1109258509 13:60113883-60113905 CTAGGGAAAGAGTTGGTAGGTGG - Intronic
1111132554 13:83996298-83996320 CTGGGTTCACAGATGGTTTGAGG - Intergenic
1111742742 13:92225069-92225091 ATGGGGCAACAGGTGGTATGGGG - Intronic
1112846065 13:103645629-103645651 CTTTGAAAACAGTTGGTATTAGG + Intergenic
1114750372 14:25197994-25198016 CTGGATAATTAGTTGCTATGGGG + Intergenic
1115778861 14:36747311-36747333 CTGGGTAAACAGCTAACATGTGG - Intronic
1118679705 14:68227393-68227415 TAAGGTCAACAGTTGGTATGTGG - Intronic
1123923903 15:25090071-25090093 CTGTGTCAACACTTGGGATGGGG + Intergenic
1127858917 15:62976848-62976870 CTGGGGGAATAGTTGGTAAGGGG - Intergenic
1128386519 15:67153169-67153191 CTGGGTAAACGCTTGCTCTGAGG + Intronic
1130236572 15:82140751-82140773 CGGGGGAAATAGTTGGAATGGGG - Intronic
1130647979 15:85745212-85745234 CTGGGTGAACTGCTGATATGCGG - Exonic
1131932032 15:97453495-97453517 CTGAGTAAACAATTGGCAAGGGG - Intergenic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1138478429 16:57285249-57285271 CTGGGTAAGCGGTGGGTAAGCGG + Intergenic
1138630457 16:58290629-58290651 CTGGTTGAACAGTTGATAAGTGG + Intronic
1140192533 16:72830053-72830075 CTGGGTAAACAGTTGGTATGAGG + Intronic
1148194829 17:45705778-45705800 CTGGGTAACCAATACGTATGTGG + Intergenic
1149532998 17:57410362-57410384 CTGGGTAAACAGCCAGCATGGGG + Intronic
1150096587 17:62381563-62381585 CTTGGTTAACAGTAGGAATGGGG - Intronic
1152425884 17:80218480-80218502 CTGGGGAAAGTGTTGGTCTGGGG - Intronic
1152650253 17:81489261-81489283 CAGGGCAGACAGGTGGTATGAGG - Intergenic
1155466193 18:26138358-26138380 CTGGGAGAACTGTTGGGATGTGG + Intronic
1156282841 18:35657781-35657803 CTGGAGAAACAGTAGGGATGTGG + Intronic
1158184580 18:54756959-54756981 CTTGGCAAACAAGTGGTATGGGG + Intronic
1159810210 18:73009872-73009894 CTGAGGAAACAGTTGTGATGAGG + Intergenic
1162779143 19:12997542-12997564 CTGGGTAGGCAGTTGTTGTGAGG - Intronic
1164268195 19:23641786-23641808 CTGGGTTAATAGTTGGAATTAGG - Intronic
1164618626 19:29681031-29681053 CTGGGGAAATGGTGGGTATGGGG - Intergenic
1165067879 19:33239548-33239570 CTGGGTTAAGGGATGGTATGGGG - Intergenic
1167734343 19:51282759-51282781 CTGGATACTCAGTTGGTATCAGG - Intergenic
1168074733 19:53973895-53973917 ATGGGTTAAGAGTTTGTATGTGG + Intronic
1168360739 19:55737880-55737902 ATAGGTGAACAGTTGGTATCAGG + Intronic
925508106 2:4592302-4592324 CTGGATGAACAATTGATATGTGG - Intergenic
926988181 2:18646890-18646912 CTGGGTCTTCAGTTGGAATGTGG + Intergenic
927268027 2:21174891-21174913 CTGGGGAAAGAGCAGGTATGGGG - Intergenic
929626357 2:43412512-43412534 CTGGGTAAACTGGTGGAATTTGG + Intronic
930849528 2:55943990-55944012 TTGGGGGAACAGTTGGTATTTGG + Intergenic
932509471 2:72271128-72271150 CTGAGGGAACAGGTGGTATGAGG + Intronic
932925936 2:75974508-75974530 TTGGGGAAACAGGTGGTCTGTGG - Intergenic
933245367 2:79969026-79969048 CAGGGTAAGCAGTTTGTCTGTGG + Intronic
933698470 2:85237698-85237720 CTGTGTAAACAGTGGGGTTGGGG + Intronic
934583235 2:95464797-95464819 TTGTGTAAACAGTTGAAATGCGG + Intergenic
934596215 2:95611917-95611939 TTGTGTAAACAGTTGAAATGCGG - Intergenic
936660050 2:114533102-114533124 TCTGGTAAAAAGTTGGTATGAGG + Intronic
940812989 2:158266495-158266517 TTGGGGAAACAGGTGGTATCTGG + Intronic
941426694 2:165355585-165355607 CTCGCCAAACAGTTCGTATGAGG - Intronic
943215216 2:185025092-185025114 TTGGGCAAACAGGTGGTATTTGG - Intergenic
945682590 2:212932034-212932056 CTGGGTAAAAACTTGATAGGAGG - Intergenic
947250082 2:228093024-228093046 TTGGGGGAACAGTTGGTATTTGG - Intronic
1168775696 20:445608-445630 CTGGGTCAAGAGTTGTTAGGTGG - Intronic
1169820557 20:9704993-9705015 CTGGGGAAACATTTGGCAAGAGG + Intronic
1170470733 20:16665412-16665434 CTGGGTCAACTGTTGGAATTCGG - Intergenic
1170980971 20:21212815-21212837 CTGTGTAGGCAGTTGGGATGGGG + Intronic
1171088721 20:22264069-22264091 CTGGGTAAACAGTGATTTTGAGG - Intergenic
1173229465 20:41182925-41182947 CTGGCTGAAGAGTTGGTCTGTGG - Exonic
1177885514 21:26741484-26741506 CTGAGTAAACAGGTGGTAAGAGG - Intergenic
1178770708 21:35501193-35501215 CTTTGTATACAGTAGGTATGGGG - Intronic
1180949910 22:19716243-19716265 CTGGGTGACCAGTGGGTCTGGGG + Intronic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
951293243 3:20900133-20900155 CAGGGTATACAGTTTATATGAGG - Intergenic
953041884 3:39262912-39262934 ATGGTTCAACAGTTGGAATGAGG + Intergenic
962082837 3:132158700-132158722 CTGGGTTTACAGTGTGTATGAGG - Intronic
962820156 3:139040549-139040571 CTGGGCAAAAATTTGGTATGTGG - Intronic
964115089 3:153128169-153128191 TTGGGGAAACAGGTGGTATTTGG + Intergenic
969487590 4:7480910-7480932 CTGGAGAAACAGGTGATATGTGG + Intronic
972915191 4:43868497-43868519 CTGGTTAACCAGTTTGTGTGAGG + Intergenic
976254150 4:83083255-83083277 CTGGGTTGACAGTGGCTATGGGG - Intergenic
977456468 4:97267771-97267793 TTGGGAAAACAGTTGGCAGGAGG + Intronic
977788860 4:101073994-101074016 CTGGGAAAACTGTTGTTACGGGG + Intronic
978742531 4:112153638-112153660 CGGGGGAAACACTGGGTATGGGG - Intronic
982743940 4:159086830-159086852 CTGGAAAAACAGCTGGTGTGTGG + Intergenic
988724611 5:33913859-33913881 TTGGGGAAACAGGTGGTATTTGG + Intergenic
990132408 5:52602947-52602969 CTGGGGAAACTGTGTGTATGGGG - Intergenic
990799121 5:59579706-59579728 CTGGGTACACACTTGGTGTGTGG - Intronic
992508640 5:77412077-77412099 CTGAGCAAACAGATGGGATGGGG - Intronic
992931936 5:81656492-81656514 CTGGGGGAACAGGTGGTATTTGG + Intronic
993768545 5:91894054-91894076 CTGGGCAAACAGTACCTATGTGG + Intergenic
994666850 5:102715616-102715638 CTGGATAAACATCTGGAATGAGG + Intergenic
994950947 5:106461504-106461526 CTGGGTACATAGTAGGTATAAGG + Intergenic
995989219 5:118215668-118215690 CTGGGTAAGCATTTTGTTTGTGG - Intergenic
998954361 5:147423573-147423595 CTGGGTTAAGAATTGGGATGTGG + Intronic
1007057328 6:38900383-38900405 CTTGATAAACATTTGGTTTGGGG + Intronic
1007926176 6:45651504-45651526 CTTGGTAAACATCTGGTAAGAGG - Intronic
1008793038 6:55262227-55262249 TTGGGGAAACAGTTGGTGTTTGG - Intronic
1010741796 6:79514955-79514977 ATGGGTAAACATGTGTTATGGGG - Intronic
1012357588 6:98335054-98335076 CTGGGTATCCACTTGGAATGTGG + Intergenic
1012812546 6:103978926-103978948 CTGGGTAACCAGTTGGCTTCTGG + Intergenic
1016328941 6:142935740-142935762 CTGGGCATACAGTTGATATTTGG - Intronic
1019011417 6:168846654-168846676 CGAAGTAAACAGTTGGTAAGAGG + Intergenic
1019940161 7:4283156-4283178 CTGGGTCTACAGTTGTGATGTGG - Intergenic
1022274223 7:28839711-28839733 CTGGGTAAAAAGAAGGTCTGAGG - Intergenic
1022390092 7:29936249-29936271 CTGAGTAAATATTTGGTATTAGG + Intronic
1023353788 7:39347090-39347112 CTGGTCAGACAGTTGGTGTGGGG + Intronic
1024905803 7:54377676-54377698 CTGGACAAACAATTGGTATCTGG - Intergenic
1025613896 7:63101701-63101723 CTGGTTATACAGCTGGTAAGTGG - Intergenic
1028059198 7:86288691-86288713 TTGGGGGAACAGTTGGTATTTGG - Intergenic
1029141918 7:98417397-98417419 GTGGGAAAACAGTAGGTCTGGGG + Intergenic
1030625346 7:111839852-111839874 TTGGGGAAACAGGTGGTATTTGG + Intronic
1030650730 7:112113289-112113311 CTGGTAAAACAGCTGGGATGAGG + Intronic
1032499151 7:132386714-132386736 CTCGGAAAACAGGTGGGATGAGG + Intronic
1033788752 7:144766190-144766212 CTGGGTAAACTTTTTGTAGGGGG + Intronic
1034944366 7:155252449-155252471 CTGTGTGAACAGTTTGTAGGAGG - Intergenic
1035725938 8:1824659-1824681 CAGGGTAAACAGGTGGGGTGCGG - Intronic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1036542374 8:9729615-9729637 CTTGTCAAACAGTTGGTAAGGGG - Intronic
1041197231 8:55412208-55412230 CTTGGTAAACGGTTGGTTTTGGG - Intronic
1041327874 8:56688496-56688518 CTGTGTAAACAGTTGGTTATGGG + Intergenic
1043278803 8:78436944-78436966 TTGGGGAAACAGGTGGTATTTGG - Intergenic
1043282983 8:78491836-78491858 ATGGGTATAGAGTTGCTATGTGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1045771533 8:105746151-105746173 CTGGGTAAATAGGTGGTCTGTGG + Intronic
1049026095 8:139990006-139990028 CAGGGTAAACAGTTTTCATGGGG + Intronic
1051687281 9:19670881-19670903 CTGGATTAACAGTTGTTATCAGG - Intronic
1052107454 9:24536747-24536769 TGGGGGAAACAGTTGGTATTTGG - Intergenic
1053014676 9:34655041-34655063 CTGGGTATACAGTGGGAAAGGGG + Intronic
1053550333 9:39072343-39072365 CTTGGTAGGCAGTTGGTATCTGG + Intergenic
1053571501 9:39313583-39313605 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1053814443 9:41892446-41892468 CTTGGTAGGCAGTTGGTATCTGG + Intronic
1054093060 9:60872285-60872307 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054114537 9:61148197-61148219 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054125644 9:61305429-61305451 CTGGGTAAAGGGTAGGTATATGG - Intergenic
1054593217 9:67034330-67034352 CTGGGTAAAGGGTAGGTATATGG - Intergenic
1054616153 9:67294994-67295016 CTTGGTAGGCAGTTGGTATCTGG - Intergenic
1055718238 9:79142168-79142190 CTGTGTAAATAGTTGTTATTGGG + Intergenic
1057601332 9:96460310-96460332 TGTGGTAAACAGTTAGTATGTGG - Intronic
1058453558 9:105118855-105118877 CTGGGTCTGCAGGTGGTATGAGG - Intergenic
1058714490 9:107711505-107711527 TTGGTCAAACAGTTGGTAAGTGG + Intergenic
1059830915 9:118094875-118094897 CTGGTTAAACAGTTTCTATAAGG + Intergenic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1062170987 9:135134466-135134488 CTGCGCAAACAGATGGTCTGGGG - Intergenic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1191945559 X:66531024-66531046 CAGGATAAACAGTTGGTTTGAGG + Intergenic
1192109352 X:68348659-68348681 CTGAGTAAACATTTTGCATGAGG - Intronic
1196993502 X:121354925-121354947 CTGGATAGAAAGTTGATATGTGG - Intergenic
1198604820 X:138325377-138325399 CTGAGAAAAAAGTTGGTAAGTGG + Intergenic
1200448092 Y:3289296-3289318 TTGGGAAAACAGTGGGTAGGAGG - Intergenic