ID: 1140194812

View in Genome Browser
Species Human (GRCh38)
Location 16:72847451-72847473
Sequence GCTCCCAGGGTACCAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140194812_1140194816 -1 Left 1140194812 16:72847451-72847473 CCATCTCTTGGTACCCTGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1140194816 16:72847473-72847495 CTCCAAGAAACTCAGTGGTCAGG 0: 1
1: 0
2: 0
3: 17
4: 146
1140194812_1140194819 16 Left 1140194812 16:72847451-72847473 CCATCTCTTGGTACCCTGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1140194819 16:72847490-72847512 GTCAGGCCCCGGAGTGTTCCAGG 0: 1
1: 0
2: 2
3: 8
4: 100
1140194812_1140194815 -6 Left 1140194812 16:72847451-72847473 CCATCTCTTGGTACCCTGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1140194815 16:72847468-72847490 GGGAGCTCCAAGAAACTCAGTGG 0: 1
1: 0
2: 3
3: 19
4: 183
1140194812_1140194818 5 Left 1140194812 16:72847451-72847473 CCATCTCTTGGTACCCTGGGAGC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1140194818 16:72847479-72847501 GAAACTCAGTGGTCAGGCCCCGG 0: 1
1: 0
2: 0
3: 21
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140194812 Original CRISPR GCTCCCAGGGTACCAAGAGA TGG (reversed) Intronic
901878998 1:12182944-12182966 GCTCTCTGGGCCCCAAGAGAAGG + Intronic
902569654 1:17338986-17339008 ACTCCCGGGGTGCCAAGAGCTGG + Intronic
903179574 1:21598386-21598408 GCTCCCCAGGTACCAGGACAAGG - Exonic
904277040 1:29391499-29391521 GCTGCCCGGGAACCAAGAGGTGG + Intergenic
904529554 1:31159292-31159314 GATCCCAGGGGCTCAAGAGAAGG + Intergenic
904942001 1:34170497-34170519 ACTCACAGGGTACCAAGGAAGGG + Intronic
906390777 1:45413787-45413809 AATCCTAGGGTTCCAAGAGATGG + Intronic
908391938 1:63691116-63691138 GCTGCCAGGAGACCAGGAGAAGG + Intergenic
916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG + Intronic
916935963 1:169628503-169628525 AATTTCAGGGTACCAAGAGAGGG + Intronic
917497743 1:175556718-175556740 CCTCCCTGGGTACCATGAGAGGG - Intronic
918981270 1:191562603-191562625 GCACCCAGGGTACAAAAGGAAGG + Intergenic
920006106 1:202835004-202835026 GCTCCCAGGGCACCTTGAGTTGG + Intergenic
920299139 1:204977759-204977781 ACACCCTGGGTGCCAAGAGAGGG - Intronic
920534052 1:206726032-206726054 GCTCTAAGGGGAGCAAGAGAAGG - Intronic
920756542 1:208739168-208739190 GCTCCCATGGGACCTAGAAAGGG - Intergenic
922067520 1:222158513-222158535 TCTCCCAAGGGACCAAGGGAAGG + Intergenic
923579653 1:235196265-235196287 GCTACCAAGGCACAAAGAGAGGG + Intronic
1063578891 10:7287541-7287563 CTTCCCAGGGCACCAAGAGATGG + Intronic
1066623503 10:37382375-37382397 GCTCCCAGGGACCCCAGAGTGGG + Intronic
1069570372 10:69491170-69491192 GAACCCAGGGGACCAGGAGAAGG - Intronic
1070164391 10:73886955-73886977 GCTCCCAGGCCACCTGGAGAAGG - Intergenic
1070942284 10:80357894-80357916 GCTCCCAGTGTGCCAAGCGTGGG + Intronic
1071808799 10:89155319-89155341 GGTCTCTGGGTACCAAAAGAGGG + Intergenic
1076055673 10:127370327-127370349 GCTCCGAGGTTATCAAGAGCCGG - Intronic
1079828114 11:25225014-25225036 GCTCCCAGGTTCCTAAGGGATGG - Intergenic
1083850584 11:65364063-65364085 GCTCCCAGGCAACAAAGATAAGG + Intergenic
1084320370 11:68370189-68370211 GCTCCCAGGGTTCTAACAGCTGG + Intronic
1084793494 11:71489698-71489720 ACCCCCAGGGTCCCAACAGAGGG - Intronic
1085495012 11:76960934-76960956 CTTCCCAGGGTACCAAAACATGG - Intronic
1088801491 11:113311469-113311491 GATCACAGGGCACCAAGTGAGGG + Intergenic
1092864973 12:12752254-12752276 GCTCCCAAAGAACAAAGAGAAGG - Intronic
1095940910 12:47726180-47726202 GCTCCCAGGGGAAGAAGAGTGGG - Intergenic
1102098974 12:110262891-110262913 GTTGCCAGGGAACCAAGGGAGGG + Intergenic
1102172443 12:110852579-110852601 GCTCCCTGTGTACCCAAAGAGGG - Intronic
1102314721 12:111878024-111878046 TCTCCCAGGTTGTCAAGAGATGG + Intronic
1104320819 12:127749188-127749210 GCACCCAGGGTACTGAGAGTTGG - Intergenic
1104638033 12:130450084-130450106 TCTCCCAGGGCACGAGGAGAAGG - Intronic
1104686299 12:130787305-130787327 GGTCCCATGGGACCAAGACATGG - Intergenic
1105700918 13:22935277-22935299 CCTCTCAGGGTACCAGGAAAGGG - Intergenic
1105770832 13:23610453-23610475 GCTCCCTTGGGACCAAGATAAGG + Intronic
1109156259 13:58913738-58913760 GCTTCCATGGGATCAAGAGATGG - Intergenic
1112506512 13:99979560-99979582 GCTCCCGAGGTAACTAGAGAGGG - Intergenic
1114260449 14:21032747-21032769 GCTGCCAGGATTCCAAGAGCAGG + Intronic
1114340225 14:21735650-21735672 GATCCCAGGGAATCAGGAGATGG + Intergenic
1114549934 14:23526804-23526826 CCTCCCAAGGTACCAGGAAAGGG - Intronic
1116048251 14:39771185-39771207 GCTTCCAGGGGAACAAGAGATGG - Intergenic
1118863381 14:69683209-69683231 GCTCCCTGGGAAGCAAGAGCTGG + Intronic
1119387352 14:74265962-74265984 GCTAACAGGCTGCCAAGAGATGG + Intergenic
1121023902 14:90600332-90600354 GCTCCCAGGGAAGCAGCAGATGG - Intronic
1121887699 14:97559809-97559831 GCTTCCAGAGCCCCAAGAGAGGG + Intergenic
1130792495 15:87170308-87170330 TCTCCCAGGATACAAAGAGATGG - Intergenic
1132355281 15:101167231-101167253 GCTGGTAGGGTACCAAGAAATGG - Intergenic
1132655935 16:1041665-1041687 GCTCCCAGGCTGCCAGGGGATGG - Intergenic
1134023431 16:10937607-10937629 GCTCGCTGTGTGCCAAGAGAGGG + Intronic
1135071997 16:19360376-19360398 GCTTCCAGGGGACAAGGAGAGGG - Intergenic
1135551324 16:23400446-23400468 GCTTCCAGGAGACCAAGAGCAGG + Intronic
1136223361 16:28843145-28843167 GCTCCTAGAGTAGGAAGAGAAGG + Exonic
1137378255 16:47973619-47973641 GCTGGCAGGGTCCCAAGAGCTGG - Intergenic
1138131842 16:54486358-54486380 ACTCACATGGTCCCAAGAGATGG - Intergenic
1140194812 16:72847451-72847473 GCTCCCAGGGTACCAAGAGATGG - Intronic
1140789754 16:78380124-78380146 GCTACCGGGTTACCAAGAGCAGG + Intronic
1141471183 16:84239724-84239746 CTTCCCTGGGCACCAAGAGATGG - Intronic
1141507299 16:84486325-84486347 CCTCCGAGGGGACCAGGAGATGG - Intronic
1141540144 16:84713843-84713865 GCCAGCAGGGTCCCAAGAGAAGG + Intronic
1141798089 16:86287924-86287946 CCTCCCTGGGGAGCAAGAGAAGG + Intergenic
1142812755 17:2402856-2402878 GCTCCGAGGGTGCCATGTGATGG - Intergenic
1143723257 17:8828470-8828492 GATCACAGGGTGGCAAGAGAGGG - Intronic
1144638042 17:16923502-16923524 GCTCCCAGGGTGACCACAGAGGG - Intergenic
1146534623 17:33639496-33639518 GCTCCCAGGGACCCCAGAGTGGG - Intronic
1146933263 17:36793094-36793116 GATCCCAGGGAACAAAGAAAGGG + Intergenic
1149649817 17:58269676-58269698 GCCCCCAGGCTTCCAAGAGATGG + Intergenic
1150861015 17:68800696-68800718 GCTCCCAGGGGACCAGAACAAGG + Intergenic
1152576265 17:81142628-81142650 GCTGGCAGGGGACCAAGAGCAGG + Intronic
1156356837 18:36349252-36349274 GCTCCAAGAGCAGCAAGAGAGGG + Intronic
1161578767 19:5069183-5069205 GCTCCCAGGGTCCCCAGCCAAGG - Intronic
1162785513 19:13032299-13032321 GCTCCCAGGGTGACAGGAGGAGG + Intronic
1166640696 19:44492865-44492887 GCTCCCAGGGCAGGAAGAGATGG - Intronic
1167861301 19:52285984-52286006 CCTCCCTGGATACCAAGGGAGGG + Intronic
929788563 2:45008498-45008520 GCTCCCCGGGGCCCAAGGGAGGG - Intronic
932581250 2:72993990-72994012 GCTCTCAGGGTACCTGGGGAAGG + Intronic
933901969 2:86856477-86856499 CCTCCCAGGCTAGCAAGAGGTGG + Intronic
935778578 2:106492795-106492817 CCTCCCAGGCTAGCAAGAGGTGG - Intergenic
939215846 2:139237222-139237244 GCTCCCAGGGCACACAGAGCAGG + Intergenic
943434521 2:187847991-187848013 GCTGCCAGGGTAGGGAGAGATGG + Intergenic
943785830 2:191877709-191877731 GTTCCCAGGGTATAAGGAGAGGG - Intergenic
945304605 2:208247053-208247075 GCTCCCAGGGGCCCAAGCAAGGG - Intronic
948034454 2:234846982-234847004 GCTACAAGGGTCCCAGGAGAAGG - Intergenic
1169252544 20:4071635-4071657 GCCCCCAGGGCACACAGAGAGGG + Intronic
1169915024 20:10674903-10674925 GCTCTCTGGGTGGCAAGAGATGG + Intergenic
1171261916 20:23741776-23741798 GCTGCCAGGGTACCTAGAAAGGG - Intergenic
1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG + Intronic
1175748717 20:61480243-61480265 GTTTCCAGGCTACCACGAGAGGG - Intronic
1176028583 20:62999119-62999141 GCTTCCAGGGCACTAACAGAAGG - Intergenic
1177895361 21:26851085-26851107 GCTCCCAGGGTATTAAGTGCAGG - Intergenic
1178604254 21:34021480-34021502 GTTCTCAGGGTCCCAGGAGAGGG - Intergenic
1181360172 22:22328056-22328078 TGTCCCAAGGTACAAAGAGATGG - Intergenic
950566488 3:13772579-13772601 GCTCCCAGGGTACTCAGAATGGG + Intergenic
951264892 3:20553185-20553207 GCACCCAGGGCACCCAGGGAGGG + Intergenic
953479471 3:43237953-43237975 ACTCCCAGGGTATCAGAAGAAGG - Intergenic
956712251 3:72048989-72049011 CCTGCCAGTGTAACAAGAGAGGG - Intergenic
956915592 3:73867765-73867787 GCTCTAAGTGTACTAAGAGAAGG - Intergenic
957486495 3:80869524-80869546 GCTCTCAGGGAAACAAGAAAAGG - Intergenic
957916454 3:86693698-86693720 GCTCAGAGGGAACCAAGAGAGGG - Intergenic
961857494 3:129887044-129887066 GTTGCCAGGGAACAAAGAGAGGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
965175415 3:165324114-165324136 GCTTCCAGGCTACCAAGATATGG + Intergenic
968800671 4:2741551-2741573 TCTGCCAGGGCACCAAGACAAGG - Intergenic
968964640 4:3763755-3763777 GCTCCTATGTTCCCAAGAGATGG - Intergenic
969204957 4:5636684-5636706 GCTTCCTGGGTATCAAGGGAGGG + Intronic
971387848 4:26157780-26157802 GGTCTCAGGGAAGCAAGAGAGGG - Intergenic
974430617 4:61791896-61791918 GGACACAGGGTACCAAGAGGAGG + Intronic
975419436 4:74145465-74145487 TCTCCCAGAATACCAAGGGATGG + Intronic
976284356 4:83356657-83356679 GCTCACAGGCTACTAAGAGAGGG + Intergenic
979893404 4:126129732-126129754 GCTCCCTGGGAACCAAAAGAGGG + Intergenic
981630864 4:146816700-146816722 GAGCCCAGGGGAGCAAGAGAGGG + Intronic
983936481 4:173506358-173506380 TCTCCCAGGTTACCAGGAGACGG + Intergenic
991639328 5:68737775-68737797 GATCCCAGGTAACAAAGAGAAGG + Intergenic
992184121 5:74227348-74227370 CATCCCAGGATACCAACAGAAGG - Intergenic
996483556 5:124003306-124003328 GCTCTCAGGATATCAAGAAAAGG - Intergenic
999153356 5:149441440-149441462 GCTCCCAGGCCAACAGGAGAAGG - Intergenic
1001595368 5:172895467-172895489 GCTCCCAGGATACAAAATGAGGG - Intronic
1003644357 6:7902388-7902410 GCTCCCACGCTCCCTAGAGATGG - Intronic
1006840677 6:37026260-37026282 AGTCCCAGGGTGCCAAGAGCTGG + Intronic
1007754461 6:44090031-44090053 GCTCCCAGGGAAACTGGAGAGGG + Intergenic
1007769861 6:44183865-44183887 GATCCCAGGGTGGGAAGAGACGG - Intronic
1010329894 6:74610808-74610830 GTACAAAGGGTACCAAGAGATGG - Intergenic
1010496426 6:76538112-76538134 GCTACCAGGAGACCATGAGATGG - Intergenic
1015017924 6:128436823-128436845 GCTGCCAGGGTATGAAGAGAAGG + Intronic
1015670692 6:135686595-135686617 TCTCCCTGGGTAGCAAGGGAAGG - Intergenic
1016941972 6:149489997-149490019 GCCCCCAGGGAACTATGAGATGG + Intergenic
1019315352 7:381638-381660 ACTCCCAGCCTAGCAAGAGAAGG + Intergenic
1019438311 7:1032935-1032957 GCTCACAGGTTTCCCAGAGAGGG - Intronic
1023613158 7:41992036-41992058 GATCCCAGGCAACCAAGAGCAGG + Intronic
1023820849 7:43979775-43979797 GCACCCAGGGAACCAAGACAAGG + Intergenic
1025093058 7:56078731-56078753 TCTCCCTGGGTACCAAGAGCTGG - Intronic
1026483904 7:70801281-70801303 GCTCCCAGGGTGACAGGAGCTGG - Intergenic
1026578925 7:71597763-71597785 GCTGCCAGGGAACCCAGAGATGG - Intronic
1026882837 7:73918452-73918474 GTTCCCAGGGTAGACAGAGAGGG - Intergenic
1029749124 7:102533212-102533234 GCACCCGGGGAACCAAGACAAGG + Intergenic
1029767067 7:102632316-102632338 GCACCCGGGGAACCAAGACAAGG + Intronic
1030765002 7:113397943-113397965 GCTTCCAGGGAATGAAGAGAGGG - Intergenic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1031910730 7:127514135-127514157 GCTCTGAGAGTACCAAGAGTAGG - Intergenic
1034450122 7:151132775-151132797 GGTCCCAGGTCACTAAGAGAAGG - Intronic
1038959206 8:32499863-32499885 GCTTCCAGGGCTCCAAGAAAAGG + Intronic
1040964707 8:53071999-53072021 GCTCCCAAGGAACCTAGAAAGGG + Intergenic
1042416988 8:68531903-68531925 ACTCCCAAAGTAGCAAGAGAAGG + Intronic
1043512732 8:80965739-80965761 GATGCCAGGGTAACAAGATAGGG - Intergenic
1048721252 8:137327823-137327845 GCTGCCAGGGGTCAAAGAGAAGG + Intergenic
1049689030 8:143950746-143950768 GCAGGCAGGGTACCACGAGAAGG + Exonic
1050210243 9:3245894-3245916 TCACCCAAGGGACCAAGAGAAGG + Intronic
1052160092 9:25247143-25247165 GCTGCCATGGTACCTAGAAAGGG - Intergenic
1054829029 9:69603008-69603030 CCTCCCAGAGGACCAGGAGAAGG - Intronic
1060157308 9:121328817-121328839 GGTCCCAGGGTCCGATGAGATGG + Intronic
1061015641 9:127979755-127979777 GCACGCAGGGCCCCAAGAGAAGG + Intronic
1061940347 9:133880560-133880582 CCGCCCAGGGGACCAAGAGATGG + Intronic
1185711571 X:2307956-2307978 TTTCCCAGGGCACCATGAGAGGG + Intronic
1185987660 X:4853833-4853855 GATCCCAGGATCCCAGGAGATGG - Intergenic
1187462030 X:19496024-19496046 GCTGCCAGGGAACCCAGAGTTGG - Intronic
1190571456 X:51786686-51786708 CCTCCCTTGGTACCCAGAGAAGG + Intergenic
1195684204 X:107570845-107570867 GCTCCCAGGGCACCCTGGGAAGG + Intronic
1197271685 X:124431310-124431332 GCTCCCAGTGTAGTAAAAGAGGG - Intronic
1199943853 X:152650134-152650156 GTTCCCAAGGTACAAACAGATGG - Intronic