ID: 1140195465

View in Genome Browser
Species Human (GRCh38)
Location 16:72851214-72851236
Sequence GGTGGGGACCAACAGATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2430
Summary {0: 1, 1: 0, 2: 3, 3: 134, 4: 2292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140195457_1140195465 1 Left 1140195457 16:72851190-72851212 CCCAGCCAGATGTTACACTCTCA 0: 1
1: 1
2: 1
3: 14
4: 132
Right 1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG 0: 1
1: 0
2: 3
3: 134
4: 2292
1140195461_1140195465 -4 Left 1140195461 16:72851195-72851217 CCAGATGTTACACTCTCAGGGTG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG 0: 1
1: 0
2: 3
3: 134
4: 2292
1140195455_1140195465 15 Left 1140195455 16:72851176-72851198 CCAGAGAGAGATGCCCCAGCCAG 0: 1
1: 1
2: 1
3: 34
4: 240
Right 1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG 0: 1
1: 0
2: 3
3: 134
4: 2292
1140195456_1140195465 2 Left 1140195456 16:72851189-72851211 CCCCAGCCAGATGTTACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG 0: 1
1: 0
2: 3
3: 134
4: 2292
1140195458_1140195465 0 Left 1140195458 16:72851191-72851213 CCAGCCAGATGTTACACTCTCAG 0: 1
1: 0
2: 2
3: 7
4: 140
Right 1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG 0: 1
1: 0
2: 3
3: 134
4: 2292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140195465 Original CRISPR GGTGGGGACCAACAGATACC AGG Intronic
Too many off-targets to display for this crispr