ID: 1140196740

View in Genome Browser
Species Human (GRCh38)
Location 16:72861415-72861437
Sequence AGTAACCCGCCTCCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140196740_1140196744 -10 Left 1140196740 16:72861415-72861437 CCCTCCCTGGGAGGCGGGTTACT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1140196744 16:72861428-72861450 GCGGGTTACTCCTCAGAGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140196740 Original CRISPR AGTAACCCGCCTCCCAGGGA GGG (reversed) Intronic
901637225 1:10675996-10676018 AGACACCTGCCTGCCAGGGATGG + Intronic
902360820 1:15941770-15941792 AGGAACCAGCCTTCCTGGGAAGG - Intergenic
903822332 1:26111981-26112003 TGTGACAAGCCTCCCAGGGAGGG - Intronic
904941569 1:34167253-34167275 AGAACCCCGCCTCCAAGAGAGGG - Intronic
907258222 1:53196652-53196674 GGTTTCCCGCCTCCTAGGGAAGG + Exonic
910277228 1:85462749-85462771 GGTAACAGGCCTCCCAGGCAGGG - Intronic
912706293 1:111917336-111917358 AGTACCCCACTTCCTAGGGAAGG + Intronic
917330311 1:173873550-173873572 AGCAACCCAGCTCCCAGGTATGG + Exonic
1064028289 10:11866801-11866823 AGGAAACCACATCCCAGGGATGG - Intronic
1069743086 10:70697935-70697957 AGCCACACACCTCCCAGGGAAGG + Intronic
1075923854 10:126235210-126235232 AGGAAGCCACCCCCCAGGGAGGG + Intronic
1076771644 10:132669342-132669364 GGGAACCCGCCTCACAGGGAAGG - Intronic
1079553229 11:21727185-21727207 AGTCCCCCTCCTCCCAGGGAGGG - Intergenic
1080563662 11:33487955-33487977 ATCATCCTGCCTCCCAGGGATGG - Intergenic
1080819371 11:35790702-35790724 AGCAACCCTCCTCCCAGGAGGGG + Intronic
1089146946 11:116336112-116336134 AGGAGGCTGCCTCCCAGGGAGGG - Intergenic
1091789646 12:3264465-3264487 AGCAAGCCGCCTCCCGGAGATGG + Intronic
1099390486 12:82073049-82073071 AGAAACCCGGCTCCCAGGTGTGG + Intergenic
1101421614 12:104555685-104555707 AGAACCCAGCCTCCCAGGCATGG - Intronic
1105255998 13:18744417-18744439 ACCAAGGCGCCTCCCAGGGATGG + Intergenic
1114494938 14:23126090-23126112 AGCACCCTTCCTCCCAGGGAAGG + Exonic
1115857873 14:37650515-37650537 AGTAAATAGCCTCCAAGGGAGGG + Intronic
1118257828 14:64220650-64220672 AGCAGCCCGCCTCCCAGAGCCGG + Intronic
1118515266 14:66521392-66521414 AGTATCCCCACTCCCAAGGATGG - Intronic
1122406725 14:101505267-101505289 AGTAACCTGCCTGTGAGGGATGG - Intergenic
1122875871 14:104664615-104664637 AGGAACCCGCATCCCAGGGCAGG + Intergenic
1202836016 14_GL000009v2_random:77611-77633 ACCAAGACGCCTCCCAGGGATGG - Intergenic
1125720339 15:41842275-41842297 AGGTACTGGCCTCCCAGGGAAGG + Exonic
1126227972 15:46293571-46293593 AGTAACCAGACTCCCAGAGCAGG - Intergenic
1128234747 15:66059799-66059821 AGAAGCCCGGCTCCCAGGCAGGG + Intronic
1129318596 15:74761427-74761449 AGTAACTTGCCCCCCAAGGAAGG + Intergenic
1131792637 15:95981624-95981646 AGTCACCCGCCACTAAGGGACGG - Intergenic
1140196740 16:72861415-72861437 AGTAACCCGCCTCCCAGGGAGGG - Intronic
1143681638 17:8480368-8480390 AGGAGCCCGTCACCCAGGGAGGG - Intronic
1147968961 17:44209536-44209558 ACCAACCCACCTCCCAGGAACGG - Exonic
1154435036 18:14336261-14336283 ACCAAGTCGCCTCCCAGGGATGG - Intergenic
1155179373 18:23330854-23330876 GGTAAGCAGTCTCCCAGGGAAGG - Intronic
1158242346 18:55391246-55391268 AGTGAACCACATCCCAGGGATGG + Intronic
1160863084 19:1245800-1245822 AGGAATCCGCAGCCCAGGGAAGG + Intergenic
1161043446 19:2122063-2122085 TGCACCCCGGCTCCCAGGGAGGG - Intronic
1161300324 19:3539307-3539329 TGTAACCTGACACCCAGGGAGGG - Intronic
1161350132 19:3786535-3786557 AGAACCCCGCTTCCCAGGGTGGG - Intronic
1162807248 19:13144381-13144403 AGGGACCAGCCTGCCAGGGAGGG + Exonic
1202636621 1_KI270706v1_random:49751-49773 ACCAAGGCGCCTCCCAGGGATGG + Intergenic
929588006 2:43128058-43128080 CATAACCTGCCTCCCAGGGTGGG - Intergenic
933187344 2:79292597-79292619 AGTACCCCATTTCCCAGGGAAGG + Intronic
938374681 2:130797784-130797806 GGACACCCGCCTGCCAGGGACGG + Intergenic
938895137 2:135742141-135742163 ACTACCCCGCGCCCCAGGGACGG + Intronic
940931969 2:159443408-159443430 AGTACCCCACCTCCCATGGGAGG + Intronic
945180847 2:207089589-207089611 ACTAACCTGCCTCTCAGTGACGG - Intronic
948290212 2:236818894-236818916 AGTAACCCAGCACCCAAGGACGG + Intergenic
948594062 2:239068216-239068238 AGGCACCCGCATCCCAGAGAGGG + Intronic
1169575507 20:6955779-6955801 AGGAGCCTGCCTCCCAGGGAAGG - Intergenic
1171360711 20:24584676-24584698 AGTACACAGCCTCCCAGGAAGGG - Intronic
1171485378 20:25481937-25481959 GGTCAGCCCCCTCCCAGGGACGG + Intronic
1173836395 20:46128799-46128821 AGGGATCCGCTTCCCAGGGAGGG + Intronic
1176291189 21:5045654-5045676 AGTAACCCGCCTGCTGGGGAAGG - Intergenic
1178887141 21:36493318-36493340 CGTGCCCTGCCTCCCAGGGAAGG - Intronic
1179866066 21:44217987-44218009 AGTAACCCGCCTGCTGGGGAAGG + Intergenic
1180364249 22:11924562-11924584 ACCAAGGCGCCTCCCAGGGATGG - Intergenic
1182107038 22:27697046-27697068 AATTAGCAGCCTCCCAGGGAAGG + Intergenic
1182446112 22:30390542-30390564 AGGCACCCTGCTCCCAGGGATGG + Intronic
965679930 3:171239811-171239833 AGCAACTAGCTTCCCAGGGATGG - Intronic
968552116 4:1229150-1229172 AGTTACCCCCAGCCCAGGGAGGG + Intronic
973366434 4:49213121-49213143 ACCAAGGCGCCTCCCAGGGATGG + Intergenic
973394177 4:49579313-49579335 ACCAAGGCGCCTCCCAGGGATGG - Intergenic
982184213 4:152779821-152779843 CGTAGCCCGCCTCCCGGAGAAGG + Intronic
986566368 5:9119034-9119056 AGCAACCCCACTCCCAGGCACGG - Exonic
989396185 5:40959529-40959551 AATAACCCACCTCCCAGTGGGGG + Exonic
991555136 5:67887260-67887282 AAGAGCCCTCCTCCCAGGGAAGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998045532 5:138983805-138983827 AGCATCCCTCCTCCCAGAGATGG + Intronic
1003856796 6:10284708-10284730 AGAAAACCGCCTACCAGAGATGG + Intergenic
1004161512 6:13218275-13218297 AGTAATTCCCCTCCCATGGATGG + Intronic
1008932635 6:56955518-56955540 AGTATCCCAATTCCCAGGGAAGG - Intronic
1019552611 7:1610654-1610676 TGTGACCAGCCTCCCAGGGCGGG + Intergenic
1021574842 7:22097416-22097438 AGTATCCCCCCTTTCAGGGAAGG - Intergenic
1023754849 7:43407108-43407130 AGAAACCCTGCTGCCAGGGAGGG - Intronic
1034416801 7:150969575-150969597 AGTCACCTGACTCCCAGGGAAGG + Intronic
1034447926 7:151122925-151122947 ACTAACCCCACCCCCAGGGAAGG + Intronic
1049017422 8:139930711-139930733 AGTAACCGGCCTTCCAGAGCTGG + Intronic
1051174356 9:14347860-14347882 AGTATCCCGCCGCCCAGCAAGGG + Intronic
1056163421 9:83920767-83920789 AGTCACCTGCCTCCGAGGGAGGG + Intronic
1057129267 9:92641886-92641908 AGTAACAGGGGTCCCAGGGAGGG + Intronic
1057756811 9:97845829-97845851 AGAAACCCACTTCCCAAGGAAGG + Intergenic
1058884432 9:109312810-109312832 AGGAACCCGGAGCCCAGGGATGG + Intronic
1062573815 9:137197464-137197486 AGAAGCCAGGCTCCCAGGGATGG + Intronic
1186273815 X:7918802-7918824 AGTAAACCCCCTGCCAGGTAGGG - Intronic
1186776872 X:12873641-12873663 AGTCCCCCTCTTCCCAGGGAAGG + Intronic
1190594226 X:52037041-52037063 AATAACCTACATCCCAGGGATGG + Intergenic
1199583499 X:149385830-149385852 AGTAGCATGACTCCCAGGGAAGG - Intergenic