ID: 1140198205

View in Genome Browser
Species Human (GRCh38)
Location 16:72873138-72873160
Sequence GTGAAAAATACGCCCATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140198205_1140198208 2 Left 1140198205 16:72873138-72873160 CCTTCAATGGGCGTATTTTTCAC 0: 1
1: 0
2: 1
3: 1
4: 67
Right 1140198208 16:72873163-72873185 CCTTCCAAAAGATCATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 124
1140198205_1140198209 3 Left 1140198205 16:72873138-72873160 CCTTCAATGGGCGTATTTTTCAC 0: 1
1: 0
2: 1
3: 1
4: 67
Right 1140198209 16:72873164-72873186 CTTCCAAAAGATCATAGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 196
1140198205_1140198206 -2 Left 1140198205 16:72873138-72873160 CCTTCAATGGGCGTATTTTTCAC 0: 1
1: 0
2: 1
3: 1
4: 67
Right 1140198206 16:72873159-72873181 ACATCCTTCCAAAAGATCATAGG 0: 1
1: 0
2: 2
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140198205 Original CRISPR GTGAAAAATACGCCCATTGA AGG (reversed) Intronic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG + Intronic
1069177001 10:65303294-65303316 GTAAAAAATAATCCAATTGATGG - Intergenic
1070030901 10:72676469-72676491 GTGATAAATCAGCCCATTGAAGG + Intergenic
1071292799 10:84199815-84199837 GAGAAAAATCCTCCCATTGCAGG - Intronic
1075434162 10:122420163-122420185 GTGAAAAATATGGACATTGGTGG + Intronic
1079394935 11:20053796-20053818 GTTACAGATACGCCCAGTGACGG + Intronic
1085714284 11:78858164-78858186 CCTAAAAATACGCTCATTGAGGG - Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1087815767 11:102656759-102656781 GTGCAAGCTATGCCCATTGAGGG + Intergenic
1094433969 12:30400403-30400425 GTAAAAAATACACCCATGGGTGG - Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1102086687 12:110147001-110147023 ATGAGAAATGAGCCCATTGAAGG + Exonic
1107404642 13:40101174-40101196 GTGAAAAACACTTCCATTAAAGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1113126984 13:106990255-106990277 GAGAAAAATAAGCCCAGTGTGGG + Intergenic
1113441194 13:110329838-110329860 GAGAGAAAAACGCCCAGTGATGG + Intronic
1126176308 15:45739013-45739035 GTGAAAAATACGGCAAATTATGG + Intergenic
1126893898 15:53237371-53237393 GTAAGATATACGTCCATTGAGGG - Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1143733757 17:8896190-8896212 GTGAAAACCAAGCCCATGGAGGG - Intronic
1148011604 17:44486394-44486416 GTTAAAATTATGCCCATTAAGGG + Intronic
1154038162 18:10826962-10826984 GTGAAAAATCCAACCTTTGAAGG - Intronic
1157666639 18:49492921-49492943 GTGAAAAATGCGCTAACTGAAGG + Intergenic
1167843590 19:52141508-52141530 GAGAAAAAAATGCCCTTTGAGGG - Intergenic
929298160 2:40271498-40271520 GTGAAAAATAGGTTCAGTGAGGG - Intronic
930246638 2:48990341-48990363 GTGAACAATACTCTTATTGAAGG + Intronic
931331269 2:61286834-61286856 GTGTAAAATACGCACGTTTATGG - Intronic
941501300 2:166280920-166280942 GTGAAAAATATGCATATTGGTGG - Intronic
1168925661 20:1577007-1577029 CTGAAAAATACTCCAATTTATGG - Intronic
1177846371 21:26292411-26292433 GTGAAAATTACTCCACTTGAAGG + Intergenic
1178551749 21:33546241-33546263 GAAACAAATACACCCATTGAAGG + Exonic
951747183 3:25992210-25992232 GTGAAAAACACACCCTTGGATGG + Intergenic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964711742 3:159678211-159678233 GTGAAAAATAGGACAATTTATGG - Intronic
965038721 3:163478558-163478580 GTGATACATAGGCCCACTGAAGG + Intergenic
966632865 3:182097832-182097854 GTGATTAATACCCCCATTTATGG - Intergenic
969114467 4:4862446-4862468 GAGAAAAATACCCACGTTGAAGG - Intronic
969903368 4:10370611-10370633 TTGAAATATATTCCCATTGAAGG - Intergenic
973882432 4:55287495-55287517 GTCAAACATACGCCCATCAAGGG - Intergenic
974414035 4:61581370-61581392 GTGAAAAACACACCCCTGGATGG - Intronic
979412148 4:120392746-120392768 GTGAAAAATTTACCCATAGAAGG - Intergenic
980550869 4:134332834-134332856 GTGAAAAATATGCACATCAAGGG - Intergenic
987581419 5:19798289-19798311 GTGAAAAATATTGCCAATGAGGG + Intronic
988146259 5:27312592-27312614 GTAAAAAATACACCCATGGCTGG + Intergenic
989179072 5:38557836-38557858 GTTCAAAATACGCACATGGATGG - Intronic
989305336 5:39948628-39948650 TTGAAAAATACCTCCATTGGGGG - Intergenic
990252374 5:53929263-53929285 CTTTAAAATACTCCCATTGAGGG - Intronic
1003687380 6:8317756-8317778 TTGAACAATTCACCCATTGAAGG - Intergenic
1009922848 6:70084373-70084395 TTGAAAAATATGGCTATTGAGGG - Intronic
1017755968 6:157529583-157529605 GTGACAAAGTCGCTCATTGATGG - Intronic
1018522384 6:164664927-164664949 GTTAAAAATACGTCCTTTGCAGG + Intergenic
1028918115 7:96282055-96282077 GTGAAAAATATTCCCAAAGAAGG - Intronic
1030981730 7:116193520-116193542 GTGAAAAATATGCCAAATAAGGG - Intergenic
1031324542 7:120377322-120377344 GTGAAAAATACATCCAGAGAAGG + Intronic
1031955923 7:127942238-127942260 GTCAAAAATAAGACCCTTGAAGG - Intronic
1033380234 7:140809755-140809777 GTGGAGAATATGGCCATTGAGGG - Intronic
1038826179 8:31004698-31004720 TTGAAAAATAATCCCATTTAAGG - Intronic
1042540302 8:69901386-69901408 GTGCAAAATAAGTGCATTGAAGG + Intergenic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1053541067 9:38974315-38974337 GTGAAAAATAAGCTCAAGGATGG - Intergenic
1053805488 9:41797360-41797382 GTGAAAAATAAGCTCAAGGATGG - Intergenic
1054625073 9:67389592-67389614 GTGAAAAATAAGCTCAAGGATGG + Intergenic
1055371376 9:75603235-75603257 GTGAATAAAACATCCATTGAGGG + Intergenic
1060925080 9:127450697-127450719 GTGAAAAAAATGCCCCTTGGAGG + Intronic
1187435957 X:19269383-19269405 GTGTAGAATTCCCCCATTGAGGG - Intergenic
1195549327 X:106149379-106149401 GTTAAACATCTGCCCATTGAAGG - Intergenic
1197626617 X:128809289-128809311 ATGAAAGATAAGCCCATTGTTGG - Intergenic
1200418451 Y:2936363-2936385 TTGAAAAATAAGCGCATCGAAGG - Intronic