ID: 1140201968

View in Genome Browser
Species Human (GRCh38)
Location 16:72902356-72902378
Sequence CCCGGACCAGCTTAATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140201962_1140201968 2 Left 1140201962 16:72902331-72902353 CCAAACACAGGCTCCCAATCAAT 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1140201968 16:72902356-72902378 CCCGGACCAGCTTAATGAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140201968 Original CRISPR CCCGGACCAGCTTAATGAGG TGG Intronic
900488263 1:2933700-2933722 CCCGGTCCTGCTCAAGGAGGAGG - Intergenic
902511779 1:16970582-16970604 CCAGGAGGAGCTTACTGAGGGGG - Intronic
907653507 1:56319273-56319295 CCTGCACCAGCCTAATGTGGTGG + Intergenic
913144413 1:115976089-115976111 CCCAAACCAGTTTAATGCGGGGG - Intergenic
913684855 1:121222112-121222134 CCCATACCACCTTAGTGAGGTGG + Intronic
914036694 1:144009733-144009755 CCCATACCACCTTAGTGAGGTGG + Intergenic
914152760 1:145058214-145058236 CCCATACCACCTTAGTGAGGTGG - Intronic
915073142 1:153288736-153288758 CCCAGACCTGCCTAATGAGGAGG - Intergenic
917601529 1:176579013-176579035 CCCCCACCACCCTAATGAGGGGG - Intronic
918239269 1:182607555-182607577 CCTGAAGCAGCTGAATGAGGAGG + Intergenic
920472170 1:206240667-206240689 CCCATACCACCTTAGTGAGGTGG + Intronic
1063414563 10:5863009-5863031 CCCGGAGCAGCTGACTGTGGTGG + Intronic
1068544073 10:58327035-58327057 CCCGGCCCAGCTTACGGAAGAGG - Intergenic
1070539770 10:77407725-77407747 TCCCCACCACCTTAATGAGGCGG - Intronic
1070957350 10:80473274-80473296 CTCTCACCAGGTTAATGAGGAGG + Intronic
1071018707 10:81027857-81027879 CCAGGACCAGCTTGATGACTTGG + Intergenic
1074904226 10:117846907-117846929 CAAGGACCAGCTGATTGAGGAGG + Intergenic
1075736339 10:124666773-124666795 CCCGGACCAGCCCCACGAGGAGG + Intronic
1079842860 11:25425844-25425866 CCCGGAGCAGCCTAACTAGGAGG + Intergenic
1081669844 11:44936866-44936888 CCCTGACCAGCTCTATGATGCGG - Exonic
1086267367 11:85017308-85017330 CCTGGACAAGTTTTATGAGGAGG - Intronic
1092054051 12:5494313-5494335 CCTGGATCAGCTTAATAATGAGG - Exonic
1105931648 13:25058120-25058142 CCCAGCCCAGCATAATCAGGAGG - Intergenic
1140201968 16:72902356-72902378 CCCGGACCAGCTTAATGAGGTGG + Intronic
1142139343 16:88465797-88465819 CTCGGATCAGCTGAAGGAGGCGG - Intronic
1142736762 17:1905851-1905873 CCAGGAACATCTGAATGAGGGGG + Intergenic
1143498936 17:7327698-7327720 CCTGGACCAGCTTGGTGAAGGGG - Exonic
1152279734 17:79378336-79378358 CCTGGACTAGCTTCATGAGGGGG + Intronic
1153655267 18:7276734-7276756 CCAGGACCAGATGGATGAGGTGG - Intergenic
1155288063 18:24312031-24312053 CCAGGACCAGCTGACTGATGAGG - Exonic
1167510199 19:49891700-49891722 GCCGGGCCAGCCGAATGAGGGGG - Intronic
927124988 2:20005915-20005937 CCAGGACCAGGTGAATGAGGTGG - Exonic
927234155 2:20855088-20855110 CCATTACCACCTTAATGAGGAGG + Intergenic
937092872 2:119218138-119218160 CCAGGACCAGCTTAGTGTGAGGG - Intergenic
942758307 2:179367826-179367848 CCTGGAACAGCTTAGTCAGGTGG + Intergenic
946401936 2:219472819-219472841 CCCGGGCCAGCTGGATGGGGAGG + Intronic
947044155 2:225959429-225959451 CTCTGACCATCTTAATGAGTGGG - Intergenic
948570438 2:238914104-238914126 CCAGGACCATCTGAAAGAGGGGG + Intergenic
1171457589 20:25280728-25280750 CCAGGCCCAGCTTGAGGAGGAGG - Intronic
1177051532 21:16240896-16240918 ACCAGACCAGCTCAATGGGGAGG + Intergenic
1177645694 21:23897824-23897846 GCCGGACCAGCTTACCCAGGAGG - Intergenic
1181511634 22:23391898-23391920 CCAGGAGGAGCTTAAAGAGGCGG + Intergenic
1181957301 22:26597258-26597280 CCCGGTGAAGCTTATTGAGGTGG - Intergenic
1183991078 22:41597366-41597388 GCTGGACGAGCTTACTGAGGTGG + Intergenic
965143139 3:164864833-164864855 ACAGGGCCAGCTGAATGAGGTGG - Intergenic
968142260 3:196267950-196267972 CCTGGCCCACCTTAGTGAGGAGG - Intronic
969056836 4:4407584-4407606 ACAGGACCAGCTGAATGGGGTGG - Intronic
984625039 4:181997351-181997373 CATGGACCACCTAAATGAGGTGG + Intergenic
984908862 4:184653221-184653243 CCAGGAGCAGCTGAAGGAGGGGG - Intronic
985533274 5:446271-446293 CCCGGACCAGCTGGACAAGGTGG + Exonic
986498865 5:8376698-8376720 ATCGGAACAGCATAATGAGGTGG + Intergenic
992348102 5:75901506-75901528 CCCTGAGCAGCCTAATGGGGAGG - Intergenic
1018025225 6:159800429-159800451 CCCGGGCGAGCTTGAGGAGGGGG + Intronic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1042332485 8:67595301-67595323 CCCCGAGCAGCCTAATGGGGAGG - Intronic
1050289850 9:4142470-4142492 CCTGGAACAGTTGAATGAGGAGG - Intronic
1059865698 9:118511602-118511624 GCCAGACCAGATTAAAGAGGAGG - Intergenic
1188104927 X:26138383-26138405 CCCGTAACAGCTTGATGATGTGG - Exonic
1201294347 Y:12450953-12450975 CCAGGACCAGCAGACTGAGGTGG + Intergenic