ID: 1140202835

View in Genome Browser
Species Human (GRCh38)
Location 16:72908190-72908212
Sequence GTGTCAATCCCCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140202835_1140202844 17 Left 1140202835 16:72908190-72908212 CCCTCCTCCCTGGGGATTGACAC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1140202844 16:72908230-72908252 CTGCAGTGAGAACATGGGAATGG 0: 1
1: 0
2: 4
3: 24
4: 305
1140202835_1140202842 11 Left 1140202835 16:72908190-72908212 CCCTCCTCCCTGGGGATTGACAC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1140202842 16:72908224-72908246 GTCATTCTGCAGTGAGAACATGG 0: 1
1: 0
2: 1
3: 20
4: 179
1140202835_1140202845 18 Left 1140202835 16:72908190-72908212 CCCTCCTCCCTGGGGATTGACAC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1140202845 16:72908231-72908253 TGCAGTGAGAACATGGGAATGGG 0: 1
1: 0
2: 1
3: 26
4: 220
1140202835_1140202843 12 Left 1140202835 16:72908190-72908212 CCCTCCTCCCTGGGGATTGACAC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1140202843 16:72908225-72908247 TCATTCTGCAGTGAGAACATGGG 0: 1
1: 0
2: 4
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140202835 Original CRISPR GTGTCAATCCCCAGGGAGGA GGG (reversed) Intronic
900009855 1:96296-96318 ATGTCAATCTCCAGGCAGCAAGG - Intergenic
900025967 1:272880-272902 ATGTCAATCTCCAGGCAGCAAGG - Intergenic
900035751 1:406737-406759 ATGTCAATCTCCAGGCAGCAAGG - Intergenic
900057373 1:642487-642509 ATGTCAATCTCCAGGCAGCAAGG - Intergenic
900755657 1:4432869-4432891 GTGGTGATCCCCAGGGATGAAGG - Intergenic
902225894 1:14996325-14996347 GTGTCAGGACCCAGGGAGAAGGG - Intronic
902648021 1:17817550-17817572 GTGAGAATGGCCAGGGAGGAGGG - Intronic
902869283 1:19303911-19303933 TTCTCAGTCCCCAGGTAGGATGG + Intergenic
912518060 1:110228205-110228227 GTGTCAGTTCCCTGGGAGGATGG + Intronic
915046650 1:153023096-153023118 GCGTCAGTCCCAAGTGAGGACGG + Intergenic
915543891 1:156585054-156585076 ATGTGTATCCCCAGGAAGGAGGG + Intronic
915733896 1:158072572-158072594 GTTTGAATCCCGAGGGAGCAGGG + Intronic
915916978 1:159946064-159946086 GGGTGGATCCCCTGGGAGGAGGG - Intergenic
917184554 1:172338598-172338620 TTGGCAATCCCCAGGCTGGAAGG + Intronic
922567394 1:226609907-226609929 GAGTAACTCCCCAGGGATGAAGG - Intergenic
922570723 1:226633355-226633377 GTGGCAAGCCCCAAGGAGCATGG + Exonic
923924814 1:238613534-238613556 GTGTTACTTCCCATGGAGGAAGG + Intergenic
1063005081 10:1962521-1962543 GAGTCAATTCACAGAGAGGAAGG - Intergenic
1063603803 10:7505914-7505936 GTTTAAATCCCCAGGAAGAAAGG + Intergenic
1063968982 10:11368144-11368166 GTGGGACTCCCCAGGGAGGAAGG + Intergenic
1063975765 10:11414307-11414329 GTTCCAGTCCACAGGGAGGAAGG - Intergenic
1064476039 10:15690172-15690194 GCTTCACTCCCCAGGGAGGTGGG - Intronic
1066995019 10:42555373-42555395 GTGTCAAGTCCCAAGGAGGCTGG - Intergenic
1069749986 10:70739024-70739046 GAGTCCCTCCCCAGGGCGGAGGG + Intronic
1070314392 10:75296241-75296263 TTGTCCAGCCCCTGGGAGGATGG + Intergenic
1071330475 10:84553905-84553927 ATGTCTGTGCCCAGGGAGGATGG + Intergenic
1071537288 10:86444651-86444673 TTGCCAGTGCCCAGGGAGGAGGG + Intronic
1074699700 10:116082389-116082411 GTGGAAAGTCCCAGGGAGGAGGG - Intronic
1075004312 10:118819234-118819256 GTGACAATCCCCGGGGATGGTGG - Intergenic
1075180108 10:120203825-120203847 GTAACAACCCCTAGGGAGGAGGG - Intergenic
1075926726 10:126257091-126257113 GTGTCAGTGTTCAGGGAGGAAGG - Intronic
1077058848 11:609020-609042 GTCCCATTCCCCAGAGAGGAAGG + Exonic
1079085003 11:17439079-17439101 GTGCCAAGCACCAGGAAGGAGGG - Intronic
1079314135 11:19393220-19393242 GTGTCATTCCCATGGCAGGATGG - Intronic
1080793979 11:35546440-35546462 GTGAGCAGCCCCAGGGAGGATGG - Intergenic
1081600092 11:44486948-44486970 GTGTCAGCCCCAAGCGAGGATGG - Intergenic
1083277260 11:61603810-61603832 ACGTCAATCTCCAGGGAGGGCGG + Intergenic
1083443047 11:62689607-62689629 TTGGCAATCACCAGGGAGGTGGG - Exonic
1083631768 11:64099115-64099137 GTGGCAATCCAGAGGGAGGCAGG - Intronic
1083650581 11:64201754-64201776 TTGTCAATCACCTGGGAGGTGGG + Intronic
1084007434 11:66330915-66330937 GGGGCCATCCCCAGGAAGGAAGG - Intronic
1090461437 11:126894983-126895005 TTGAAAATCCCCAGAGAGGATGG - Intronic
1092055178 12:5502993-5503015 GAGTCAAGCCCCAGGGAGAATGG + Intronic
1094222904 12:28013386-28013408 TTTTCAGTCCCCAGGGAGTATGG + Intergenic
1096145519 12:49276183-49276205 GTGACTGGCCCCAGGGAGGATGG - Intergenic
1098959017 12:76719082-76719104 GTGGCACTCCCGAGGGATGAGGG - Intergenic
1104088225 12:125494289-125494311 GTGGCCATTTCCAGGGAGGAGGG - Intronic
1104088250 12:125494357-125494379 GTGCCCATTTCCAGGGAGGAGGG - Intronic
1104088412 12:125494837-125494859 GTGGCCATTTCCAGGGAGGAGGG - Intronic
1106454183 13:29912146-29912168 TTGTCACTCCCCTGGAAGGAAGG + Intergenic
1107172846 13:37363416-37363438 CTGTCAGTCCCCAGTGGGGATGG + Intergenic
1108595654 13:51946372-51946394 GTGGCCAGCCCCAGGGAGCAGGG + Exonic
1118853834 14:69606019-69606041 GAGACAATCTGCAGGGAGGAAGG - Intergenic
1118942501 14:70350343-70350365 GCGTCAACCCCAAGTGAGGACGG - Intronic
1119044759 14:71308806-71308828 GTGGCAGTTCCCAGGGAAGAGGG - Intergenic
1119712973 14:76836343-76836365 TTGTGAATCCCCAGGGATGATGG - Intronic
1121654738 14:95587138-95587160 GGGACAGCCCCCAGGGAGGAGGG - Intergenic
1122638574 14:103142955-103142977 GTGGCAATACCCAGGAAAGATGG - Intergenic
1126342999 15:47664561-47664583 ATGTCACACCCCAGTGAGGAGGG - Intronic
1127796203 15:62440537-62440559 GTGCCAAACGTCAGGGAGGACGG + Intronic
1128145756 15:65331688-65331710 TGGTCAACCTCCAGGGAGGAGGG - Intronic
1129248655 15:74295953-74295975 GTGTCTCTCCCCAGGTGGGAAGG + Intronic
1129408933 15:75338289-75338311 GAGCCAGTCCCCAGGAAGGAGGG + Intronic
1129733011 15:77942497-77942519 GAGCCAGTCCCCAGGAAGGAGGG - Intergenic
1132068966 15:98758635-98758657 GAGTCCATCCACAGGGAAGAAGG - Intronic
1132500650 16:283275-283297 GAGGAAATCCCCAAGGAGGATGG + Exonic
1132651892 16:1025069-1025091 GTGTGAACACCCAGGCAGGATGG - Intergenic
1132928648 16:2446946-2446968 GTGTCATTCCCATGGAAGGAGGG + Intronic
1133900882 16:9973245-9973267 TAGGCAATCCCCAGGCAGGAAGG + Intronic
1135415224 16:22263813-22263835 CTGTGAGGCCCCAGGGAGGAGGG + Intronic
1137445532 16:48529618-48529640 GTGTGAGTCCCCATGGTGGAGGG - Intergenic
1139483669 16:67244658-67244680 CTGTACATCCCCAGGGAGGGGGG + Intronic
1140202835 16:72908190-72908212 GTGTCAATCCCCAGGGAGGAGGG - Intronic
1140787427 16:78356434-78356456 ATCTCAGTCCCCAGGCAGGAAGG + Intronic
1141893170 16:86941576-86941598 GTGCCAAGCCCCAGGTAAGAGGG + Intergenic
1142375539 16:89705102-89705124 GTGTCCATCCCCGGGCAGGAAGG - Intergenic
1142454475 16:90210608-90210630 ATGTCAATCTCCAGGCAGCAAGG + Intergenic
1142737220 17:1908606-1908628 GAGTCGAACCCCAGGGAGAATGG - Intergenic
1142768195 17:2077560-2077582 GTGTCACTGTCCAGGCAGGAGGG + Intronic
1144649476 17:16998177-16998199 GTGTCTATCCCAAGGGGGGCAGG + Intergenic
1148161596 17:45453384-45453406 GTGGCTATCCCCATGGAGAAAGG - Exonic
1148485371 17:47987482-47987504 CTGGCAGTCACCAGGGAGGAAGG - Intergenic
1148584718 17:48769226-48769248 GTGGCACTCCCCAGGCAGGGAGG + Exonic
1149340745 17:55683634-55683656 ATGTCATTCCCCGGGGAGGAGGG + Intergenic
1150392833 17:64800029-64800051 GTGGCCATCCCCATGGAGAAAGG - Intergenic
1151475675 17:74343195-74343217 GTGACCAGCCCCAGGGAGGGAGG - Intronic
1151560840 17:74868778-74868800 GGTTAAATCCTCAGGGAGGAGGG - Intronic
1153365044 18:4246576-4246598 GTGTCAAACCCCAGGGTGAAAGG + Intronic
1153452506 18:5245287-5245309 GAGTCACTCCCCAGGAAGGGTGG + Intergenic
1155490628 18:26398053-26398075 GTGACAGCCCTCAGGGAGGAGGG - Intergenic
1156084606 18:33383147-33383169 CTGTCCATGCCCAGTGAGGAGGG - Intronic
1158212511 18:55067142-55067164 GTCTGAATTCCCTGGGAGGAAGG - Intergenic
1160108868 18:76006211-76006233 GTGTCAATACCCAGGGGCAAGGG - Intergenic
1160679481 19:406242-406264 GTGGCAGCCCCCAGCGAGGACGG + Exonic
1160884683 19:1340256-1340278 GTGCCAGTCCCCAGGACGGAAGG - Intergenic
1162778337 19:12993749-12993771 GTGTCAGTGCCCAGGGCGGGGGG - Intergenic
1163324605 19:16595080-16595102 GTGTGAATCCGCAGTGAGGGAGG - Intronic
1163386282 19:17002107-17002129 GGGGCACACCCCAGGGAGGAGGG + Intronic
1163700036 19:18782363-18782385 GTGTCACCCCTGAGGGAGGAGGG - Intergenic
1163830879 19:19546666-19546688 GTGTCAGGCTCTAGGGAGGAAGG + Intergenic
1166689431 19:44813679-44813701 GTGTGAAGCCCCCGGGTGGAGGG - Intronic
1167477320 19:49708672-49708694 GCCTCAGTCCACAGGGAGGAAGG + Intronic
1168137315 19:54360247-54360269 GTGACCAGCCCCAGGGAGAATGG - Intronic
1168160762 19:54508838-54508860 GTGACCAGCCCCAGGGAGAATGG + Intronic
926123547 2:10257601-10257623 GCCTCACTGCCCAGGGAGGATGG + Intergenic
926205915 2:10834391-10834413 GTGGCCAGCCCCAGGGAGGGAGG - Intronic
926219124 2:10923484-10923506 GTGTCAATCCCCAGACTGCATGG + Intergenic
927049561 2:19313627-19313649 GTATCAATCCCCACGGAGGCAGG - Intergenic
927186987 2:20488971-20488993 GAGCCATTCCCCAGGGAAGAGGG + Intergenic
927695458 2:25236727-25236749 GCGACACTCACCAGGGAGGAAGG + Intronic
927778899 2:25923736-25923758 GTGTCCATCACCCAGGAGGATGG - Intergenic
929809419 2:45176671-45176693 GAGCAAATCCCCAGAGAGGAGGG + Intergenic
931364275 2:61605460-61605482 GTGTCATTCCCCAGTGACGTGGG + Intergenic
933607036 2:84393962-84393984 GAATCCATCCCCAAGGAGGAAGG - Intergenic
933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG + Intronic
934712605 2:96525896-96525918 CTGTTAATCCCAAGGGATGAAGG - Intergenic
937227114 2:120376276-120376298 GGGTCTTTCCCCAGGGACGAGGG + Intergenic
937828375 2:126392556-126392578 GTGTCTCTCCCCAGGGTGTATGG - Intergenic
937872171 2:126793767-126793789 GCGTCAGTCCCCAAGGAGGGAGG + Intergenic
938184978 2:129223425-129223447 GTGGCCATCCCCAGGCAGTAGGG - Intergenic
941862603 2:170299351-170299373 GTGGCAATGTCCAGGGAGCAAGG - Intronic
942045700 2:172098059-172098081 GGTTCAAACCCCAGGTAGGAAGG + Intergenic
942139595 2:172964697-172964719 GGCTCAATCCCAAGGGATGATGG - Intronic
945198335 2:207257794-207257816 GTGTAAACCCCCAGGGAGCAGGG - Intergenic
946349163 2:219137194-219137216 ATGAAAATCTCCAGGGAGGAAGG - Intronic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
949085933 2:242155263-242155285 ATGTCAATCTCCAGGCAGCAAGG + Intergenic
1169401176 20:5282111-5282133 GTGTCAATCATCATGGTGGACGG + Intergenic
1172154018 20:32811006-32811028 GTCTCAATACCCGGGGAGGCAGG - Intergenic
1172482018 20:35277001-35277023 GTGTCATTTCCCTGGGATGAGGG + Intergenic
1172763322 20:37336888-37336910 GTGGGAATCCCCTGGGAGGGTGG + Intergenic
1173626897 20:44479783-44479805 CTGTTAGTCCCCAGGGAGGCAGG - Intronic
1174138997 20:48399957-48399979 GTTACCATCCCCGGGGAGGATGG + Intergenic
1176058792 20:63162789-63162811 CTGCCCATCCCCAGGGAGCAGGG + Intergenic
1176106914 20:63393766-63393788 GTGCCAGCCCTCAGGGAGGACGG + Intergenic
1177353457 21:19976156-19976178 GTGTCAATTCCCAAGGAGGCGGG - Intergenic
1178105433 21:29313820-29313842 ATGTCAATGCCCTTGGAGGAAGG + Intronic
1179884417 21:44307316-44307338 GTGTAAATACCCAGGACGGAGGG - Intronic
1181481128 22:23199757-23199779 GAGTCATTCCCAAGGGAGGAGGG + Intronic
1182521873 22:30889397-30889419 GTGCCAGTCCTCAGGGTGGAGGG + Intronic
1184452715 22:44592502-44592524 GTGTCAAACCTCAGGGTGGTGGG - Intergenic
1185179391 22:49350339-49350361 GTGTGAGAGCCCAGGGAGGAGGG + Intergenic
1185296998 22:50059210-50059232 GTGGCATTCCCCGGGGAAGAGGG - Intergenic
950273527 3:11639256-11639278 GAGCCAGTCCCCAGGGAGCAGGG - Intronic
950966903 3:17152795-17152817 GTGTCCCTCCCCAGGGGGAAAGG + Intergenic
951805904 3:26643153-26643175 GTGTCCAGCCCCAAGGAGAAGGG - Intronic
957040370 3:75331595-75331617 GTGTCCATCCACTGGGAGGGAGG - Intergenic
958937428 3:100272028-100272050 GTCTCCATCCACAGGGAGTATGG + Intronic
960432568 3:117587592-117587614 CTGTAAGTCCCCAGGGAGGGTGG - Intergenic
960968744 3:123124188-123124210 TGGTCAATCACCAGGGAGGGAGG - Intronic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
966051111 3:175618639-175618661 GTGTCACTCCAAAAGGAGGAAGG - Intronic
969475612 4:7421018-7421040 GTCTCCATCTCCAAGGAGGAGGG - Intronic
970793435 4:19887413-19887435 GCATCAGTCCCAAGGGAGGATGG - Intergenic
971480579 4:27111032-27111054 GTGTCAGCCCCAAGTGAGGACGG + Intergenic
976395474 4:84550532-84550554 GTCTGAGTTCCCAGGGAGGATGG + Intergenic
977181168 4:93876399-93876421 GTGTCAAACAGCAGGGATGAGGG + Intergenic
978334258 4:107648826-107648848 ATGATAATCCCAAGGGAGGAGGG - Intronic
981114606 4:140975406-140975428 GAACCAATCCCCAGGGAAGATGG + Intronic
983209058 4:164940032-164940054 GTGTGATTCTCCAGGAAGGAGGG + Intergenic
983209920 4:164948015-164948037 GTGTGATTCTCCAGGAAGGAGGG - Intergenic
984698286 4:182800439-182800461 GTCTCATTCCCCCGGGAGGAAGG - Exonic
985689685 5:1300205-1300227 GTGGCAGCTCCCAGGGAGGACGG + Intergenic
990155806 5:52876053-52876075 GTGAAAATCCTCAAGGAGGAAGG - Intronic
990424776 5:55676051-55676073 GTGGTCATCCCTAGGGAGGATGG + Intronic
990768688 5:59217825-59217847 TTGTCAATTCCCAGGAAGGCTGG + Intronic
991972832 5:72157544-72157566 CAGTCAGTCCCCAGGGAGGGTGG - Intronic
997283583 5:132663284-132663306 GGCTCAGTCCCCAGGGAGGGAGG - Intergenic
998175047 5:139896554-139896576 GACTAAATACCCAGGGAGGAAGG - Intronic
998619901 5:143782388-143782410 TTGACAAGCCCCAGGGAGAAAGG - Intergenic
1001826641 5:174751042-174751064 GTAACAATTCCCATGGAGGAAGG + Intergenic
1001981402 5:176040355-176040377 GTGTCAATGGCCAGGGGAGAAGG - Intergenic
1002174484 5:177393847-177393869 GTGTCCAGCCCCAGGAAGCATGG + Intronic
1002236063 5:177803711-177803733 GTGTCAATGGCCAGGGGAGAAGG + Intergenic
1002738070 5:181412127-181412149 ATGTCAATCTCCAGGCAGCAAGG + Intergenic
1003146471 6:3514501-3514523 GTCTCAATCCACAAGGAGGCAGG + Intergenic
1003785605 6:9483068-9483090 GTGTCAATACACAGCGATGAAGG + Intergenic
1004788526 6:18997388-18997410 GTCTCAGCCCCTAGGGAGGAAGG - Intergenic
1008134058 6:47752786-47752808 GTGTGAAGCCACAGGGAGGGAGG - Intergenic
1009228217 6:61036514-61036536 GTGTCAACCCCCTGGGATGTCGG + Intergenic
1009808787 6:68635342-68635364 GTTTGAATGCCCAGCGAGGAGGG - Intergenic
1012419830 6:99052560-99052582 GTGGCAATGCACAGGAAGGAGGG + Intergenic
1013595160 6:111654029-111654051 CTGTCAATTCCCAGAGAGGGAGG - Intergenic
1015876654 6:137829144-137829166 GTGTCAATCATCAGGAAAGAGGG - Intergenic
1018512016 6:164534263-164534285 ATGTGCTTCCCCAGGGAGGAAGG - Intergenic
1018903936 6:168064422-168064444 GTGGCATCCCCCTGGGAGGAGGG - Intronic
1019243171 6:170687686-170687708 ATGTCAATCTCCAGGCAGCAAGG + Intergenic
1021439378 7:20660798-20660820 GATTCTATCACCAGGGAGGAGGG - Intronic
1021562897 7:21986562-21986584 GTGAGAATTACCAGGGAGGAAGG - Intergenic
1022419763 7:30209480-30209502 GTGTCTTTTCCGAGGGAGGAAGG - Intergenic
1023297388 7:38729608-38729630 TTGTCATTCTCCAGGCAGGAAGG - Intronic
1023572382 7:41585641-41585663 GTGGCAATGCCAGGGGAGGAAGG - Intergenic
1024363490 7:48494137-48494159 GCTGCAAACCCCAGGGAGGAAGG + Intronic
1029335679 7:99897383-99897405 GTGTAAAATCCCAGGGAGGGTGG - Intronic
1030909826 7:115233416-115233438 GCTTCAGTCCTCAGGGAGGAAGG - Intergenic
1032557493 7:132852407-132852429 GTGTCAATGCCATGGGAGGGAGG + Intronic
1033422592 7:141216959-141216981 GTGTCACTGGCCAGTGAGGAGGG + Intronic
1034568792 7:151937926-151937948 ATTTCAATCCCCAGGGAACAGGG - Intergenic
1035010429 7:155710958-155710980 GAGTCAATCCCCACGCAAGAGGG - Intronic
1035405380 7:158593657-158593679 TTGTTAGTCCCCAGGCAGGAAGG + Intergenic
1035504951 8:120477-120499 ATGTCAATCTCCAGGCAGCAAGG - Intergenic
1035618710 8:1022145-1022167 CTGTCCACCCCCAGGGAGGATGG - Intergenic
1035618738 8:1022255-1022277 GTGTCCACTCCCAGGGAGGATGG - Intergenic
1035618826 8:1022585-1022607 GTGTCCACTCCCAGGGAGGATGG - Intergenic
1035618855 8:1022695-1022717 CTGTCCACCCCCAGGGAGGGTGG - Intergenic
1035619067 8:1024165-1024187 CTGTCCACCCCCAGGGAGGGTGG - Intergenic
1035619101 8:1024275-1024297 CTGTCCACCCCCAGGGAGGGTGG - Intergenic
1035619121 8:1024330-1024352 CTGTCCACCCCCAGGGAGGGTGG - Intergenic
1035619141 8:1024385-1024407 CTGTCCACCCCCAGGGAGGGTGG - Intergenic
1035619161 8:1024440-1024462 CTGTCCACCCCCAGGGAGGGTGG - Intergenic
1036949736 8:13129794-13129816 TTGGCAATAGCCAGGGAGGAAGG + Intronic
1037766286 8:21774336-21774358 GTATCACTTCCCAAGGAGGATGG + Intronic
1038328181 8:26588137-26588159 GTGTCAGTACCCAGCAAGGATGG - Intronic
1038349042 8:26760004-26760026 CTGAGAGTCCCCAGGGAGGAAGG + Intronic
1040634056 8:49251760-49251782 GTGTGCAGCCCCAGGGACGACGG - Intergenic
1049017415 8:139930649-139930671 GTGTTTAGCCCCATGGAGGAGGG + Intronic
1049025439 8:139984970-139984992 TTGCCAATCCCCAGCGAGGAGGG + Intronic
1052001929 9:23294258-23294280 ATATCAGTCCCCAGGGAGAACGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1062682482 9:137789187-137789209 GTGTCCTTCCCCGGGGAGGAGGG - Intronic
1203603360 Un_KI270748v1:36910-36932 ATGTCAATCTCCAGGCAGCAAGG + Intergenic
1186350295 X:8732538-8732560 GGGTCAATCCCCAGGCAGGTGGG - Intergenic
1190276752 X:48904143-48904165 TTGTGAGTCCCCAGGGAGAAAGG - Exonic
1192893654 X:75417175-75417197 GTGTCCATCACCAGGGCTGATGG + Exonic
1193575170 X:83186580-83186602 GTGGCAACCCCCAGGGAGATGGG + Intergenic
1199492994 X:148421946-148421968 GGGTCATTCCCCAGGAAGAAGGG - Intergenic
1201264664 Y:12194187-12194209 GTTCCAATCCCCAGTGTGGAAGG + Intergenic