ID: 1140207986

View in Genome Browser
Species Human (GRCh38)
Location 16:72949073-72949095
Sequence AGTGCTTAAGAAAGCACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140207986_1140207988 10 Left 1140207986 16:72949073-72949095 CCTAAAGTGCTTTCTTAAGCACT 0: 1
1: 0
2: 0
3: 24
4: 232
Right 1140207988 16:72949106-72949128 GGCCTCCCCACATCCTGAGAAGG 0: 1
1: 1
2: 5
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140207986 Original CRISPR AGTGCTTAAGAAAGCACTTT AGG (reversed) Intronic