ID: 1140210969

View in Genome Browser
Species Human (GRCh38)
Location 16:72969945-72969967
Sequence CCTTCTGGGCAGTGGGCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140210969_1140210979 2 Left 1140210969 16:72969945-72969967 CCGGACGCCCACTGCCCAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 181
Right 1140210979 16:72969970-72969992 CAGAGAATCGCCCAGGCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1140210969_1140210978 1 Left 1140210969 16:72969945-72969967 CCGGACGCCCACTGCCCAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 181
Right 1140210978 16:72969969-72969991 CCAGAGAATCGCCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 99
1140210969_1140210975 -5 Left 1140210969 16:72969945-72969967 CCGGACGCCCACTGCCCAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 181
Right 1140210975 16:72969963-72969985 GAAGGCCCAGAGAATCGCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140210969 Original CRISPR CCTTCTGGGCAGTGGGCGTC CGG (reversed) Intronic
900129942 1:1083129-1083151 CCTTAGGGGCAGGGGGCATCTGG - Intronic
900370387 1:2329569-2329591 CCCACTGGGCAGTGGGTCTCAGG - Intronic
900528443 1:3140762-3140784 CCTCATGGGCTGTGGGGGTCTGG - Intronic
901771297 1:11531649-11531671 CCCACGGGGCAGTGGGCGTCAGG + Exonic
901772757 1:11538987-11539009 CCTTCAGGGCTGTGTGCTTCGGG - Intergenic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903671020 1:25035249-25035271 GCTTCTGGAGAGTGGGCCTCAGG + Intergenic
904465707 1:30706112-30706134 CTTTCTGTGCAGTGAGCGGCAGG + Intergenic
904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG + Intergenic
905472579 1:38204597-38204619 CCTTCAGGGCATTGGTCATCTGG + Intergenic
905878365 1:41447967-41447989 CCATCTGGGCAGGGAGTGTCTGG + Intergenic
906338730 1:44958822-44958844 GCTCCTGAGCAGTGGGCTTCTGG + Intronic
906447689 1:45917512-45917534 CCTCCACGGCAGTGGGCGGCTGG - Intronic
906478244 1:46184204-46184226 CCCTGTTGGCAGTGGGCATCTGG + Exonic
912013096 1:104996156-104996178 CCTTCTGGAGAGTGGGGGTATGG - Intergenic
912306370 1:108571724-108571746 CCTCCTAGGAAGTGGGCGGCAGG - Intronic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
915019938 1:152769640-152769662 TCTTCTGGGGTGTGGGAGTCAGG + Intronic
918110788 1:181453687-181453709 CCTTCTGTCCAGTTGGCTTCTGG - Intronic
918487710 1:185046156-185046178 CCTTCTGGGGGGTCGGAGTCGGG + Intronic
919606826 1:199693647-199693669 CTTTCTGGGAAGTGGGGGACAGG - Intergenic
920232585 1:204480535-204480557 CCTTCTGGGTACTGGGGCTCTGG - Intronic
920564348 1:206961514-206961536 CCTGCTGGGCGGTGGGCCTCTGG - Intronic
923328792 1:232903523-232903545 CATGATGGGCAGTGGGAGTCAGG - Intergenic
923991712 1:239445001-239445023 CCTTGTGTGCAGTGGGCCACTGG + Intronic
1063053386 10:2477171-2477193 CCTGCTGGGCCCTGGGCCTCAGG - Intergenic
1064952275 10:20866206-20866228 CATTCTGGGAAGGGGGCGTTGGG + Intronic
1066685303 10:37976282-37976304 GGTGCTGGGCAGTGGGCGCCCGG - Intronic
1070765847 10:79055866-79055888 CCTTCTGGGAAGTAGGGGGCTGG + Intergenic
1073514631 10:104065494-104065516 CCTTGTGGACAGTGGGTCTCTGG - Intronic
1074071849 10:110079381-110079403 CCTTCTGGGGAGTGGGGCTGAGG - Intronic
1075738639 10:124679667-124679689 CCTGCTTGGCAGTGGGTCTCGGG - Intronic
1076664298 10:132077284-132077306 GGTTCTGGGCAGGGGGTGTCCGG + Intergenic
1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG + Intergenic
1077239174 11:1501733-1501755 CCAGCTAGGCAGTGAGCGTCGGG + Intergenic
1077662204 11:4079750-4079772 CCTACTGGGAAGTGGAAGTCAGG + Intronic
1081712565 11:45226760-45226782 CCTTCTCGGCCTTGGGCATCCGG + Intronic
1083224191 11:61274216-61274238 CCACCTAGGCAGTGGGCTTCCGG + Intronic
1084595463 11:70114220-70114242 CCTTCTGGGCTGTGCGCCCCTGG - Intronic
1087118092 11:94544898-94544920 CCTCCTCGGCAGTGTGCGCCTGG - Exonic
1088756562 11:112890036-112890058 CCTTCTGGGCAGTGGATCTTTGG - Intergenic
1094254510 12:28407168-28407190 CCTTTTGGGGAGTAGGCCTCAGG - Intronic
1101639991 12:106581003-106581025 CCTTCTGGGCACTGGGCATGGGG + Intronic
1104778377 12:131404522-131404544 CCTTCTGGACAGAGGCAGTCGGG - Intergenic
1104935399 12:132361547-132361569 CCTTCTGTGTAGCGGGCGTCGGG + Intergenic
1105212173 13:18263421-18263443 CCATATGGGCAGTGGGGCTCGGG - Intergenic
1106944081 13:34806011-34806033 CCTACTGAGAAGTGGGCATCTGG + Intergenic
1111207017 13:85024277-85024299 CTTTCTGTGCAGTGAGCATCAGG - Intergenic
1113595422 13:111528426-111528448 CCTGCTGTCCAGTGGGCTTCTGG + Intergenic
1117341756 14:54797887-54797909 CCTTCCGGGCAGTGGGCCATGGG - Intergenic
1121283214 14:92714441-92714463 CCTTCTTGGCAGTGGCCCCCAGG - Exonic
1125920537 15:43522979-43523001 CCTTCTGGGCTGGGGGTGTCTGG - Exonic
1126851585 15:52800348-52800370 ACTCCTGCGCAGTGGGCTTCTGG - Intergenic
1128979357 15:72175318-72175340 CCCTCTGGGCAGTGTGCATGTGG - Intronic
1129377482 15:75143234-75143256 CCTTATGGGCAGTTGGGGCCTGG + Intergenic
1132409335 15:101564878-101564900 CCTTCTGGGCTGTGGTCATCAGG - Intergenic
1132675791 16:1120817-1120839 CTTGCTTGGCAGTGGGGGTCCGG - Intergenic
1132888799 16:2194387-2194409 CCTTCAGGGCAGGGCGAGTCGGG + Intronic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1137442844 16:48511022-48511044 CCTACTGGGCAGCTGGGGTCAGG - Intergenic
1137622097 16:49882964-49882986 CATTCAGGGTAGGGGGCGTCTGG - Intergenic
1138229428 16:55326455-55326477 ACTGCTGGGCAGTGCGCGACCGG + Exonic
1138349081 16:56336924-56336946 CCCTCTGAGCACTGGGCCTCGGG + Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1141991958 16:87615673-87615695 CCTTCTGGGCAGCCCGGGTCAGG - Intronic
1142314404 16:89334537-89334559 CCATGTGGGCAGTGGGCATGCGG + Intronic
1142425792 16:90001613-90001635 CCTTCTGGGCTCTGAGCTTCAGG + Intergenic
1143134545 17:4704170-4704192 CCTACTGGGGAGGGGGCGTGGGG + Exonic
1145158000 17:20555652-20555674 CGGTCTGGTCAGTGGGGGTCTGG - Intergenic
1146182182 17:30705601-30705623 CCTGGTGGGCAGTGGCTGTCTGG + Intergenic
1147627372 17:41908890-41908912 CCCTCTGGCAAGTGGGAGTCTGG + Intronic
1148240736 17:45998052-45998074 CCTTCTGGGCACTGGGCCTCGGG + Intronic
1150645161 17:66973357-66973379 CCTTCTGGGCATTGTGGGTAGGG - Intronic
1150895512 17:69205767-69205789 GCTTCTGGGCAGTGGGGCTGGGG + Intronic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1157181040 18:45498416-45498438 ACTTCTTGGCTCTGGGCGTCTGG - Intronic
1160691858 19:463974-463996 TGCTCTGGGCAGTGGGCGCCAGG + Exonic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1165176547 19:33934590-33934612 CCTTCTGGGCAGTGGTCTTTGGG - Intergenic
1165258106 19:34592188-34592210 CATTTTGGGCAGTGGGAGTGAGG + Intergenic
1166110923 19:40622504-40622526 CCCTGTGGGGAGTGGGCGCCGGG + Exonic
1167282194 19:48576087-48576109 CCTGCCGGGCTGCGGGCGTCGGG + Intronic
1168201395 19:54818244-54818266 TCTTCTGGGCACTGGGAGTGAGG + Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
934301451 2:91778981-91779003 CCATATGGGCAGTGGGGCTCAGG + Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
935268790 2:101416106-101416128 CCATCTGGGCAGTGGAGGCCAGG + Intronic
936161261 2:110085823-110085845 CCTCCTGGGCAGTGGGGCTGAGG - Intronic
936183402 2:110285531-110285553 CCTCCTGGGCAGTGGGGCTGAGG + Intergenic
936288636 2:111200699-111200721 CTGTCTGTGAAGTGGGCGTCTGG + Intergenic
937910221 2:127072058-127072080 CCTTCAGGGCAGGAGGCGACTGG - Intronic
937919769 2:127120888-127120910 CAGTCTGGGCAGTAGGCTTCAGG - Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
942896517 2:181062142-181062164 ACTTCTGAGCAGTTGGAGTCAGG + Intronic
944229392 2:197377727-197377749 CCTGCTGGGCACTGGACGTAGGG + Intergenic
947524251 2:230868794-230868816 CCTCTTGGCCAGTGGGCATCAGG - Intronic
947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG + Intergenic
948745420 2:240089389-240089411 CCGTCTGGGGAGTGGGGGTGGGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169262692 20:4149483-4149505 CCCTCTGGGCTCCGGGCGTCCGG + Intronic
1172183268 20:33016389-33016411 TCTTCTGGGCAAGGGGCTTCAGG + Intronic
1172250523 20:33476025-33476047 CTTTCTGGGCTGTGGGCGGATGG - Intergenic
1172461965 20:35125919-35125941 CATTCTTGACAGTGGGCCTCAGG - Intronic
1174708982 20:52685268-52685290 CCTTTTGGGGAGTGGGAGTGGGG - Intergenic
1175605339 20:60308075-60308097 CCTTCTTGGCAGTGTGCACCAGG - Intergenic
1176217580 20:63955660-63955682 CCTTTGGGGCCGTGGCCGTCAGG - Intronic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1179561696 21:42219606-42219628 GCTTCTGGGCGGGGGGCGTGGGG + Intronic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180814984 22:18783741-18783763 CCATATGGGCAGTGGGGCTCGGG - Intergenic
1180867323 22:19127023-19127045 CCCACTGGGCAGTGGGAGCCAGG - Intergenic
1181201173 22:21218078-21218100 CCATATGGGCAGTGGGGCTCAGG - Intronic
1181700569 22:24618889-24618911 CCTTATGGGCAGCGGGGCTCAGG + Intronic
1182144935 22:27991739-27991761 CGTTCTGGCCAGTGAGGGTCTGG - Intronic
1183619520 22:38964511-38964533 CCCTCTGGGCTGTAGGGGTCGGG + Intronic
1184387706 22:44185824-44185846 CCTTCCGGGAAGTGGGTGGCAGG - Exonic
1203225740 22_KI270731v1_random:77353-77375 CCATATGGGCAGTGGGGCTCAGG + Intergenic
1203265088 22_KI270734v1_random:9431-9453 CCATATGGGCAGTGGGGCTCAGG - Intergenic
953841479 3:46393190-46393212 CCTTCTGGACAGTGAGTCTCAGG - Intergenic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954869718 3:53758523-53758545 CCTGCTGGACAGTGGGCTCCTGG - Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
956721519 3:72122168-72122190 CCTTCTGGGAGCTGGGCGTGGGG - Intergenic
960197404 3:114786290-114786312 CCTGTTGGGGAGTGGGGGTCTGG - Intronic
961473306 3:127131988-127132010 CCTTCTGAGCCCTGGGTGTCTGG + Intergenic
972161243 4:36230821-36230843 GCTTATGGGCAGTTGGCGTGTGG - Intronic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
978403008 4:108350382-108350404 GCCTCTGGGCTGTGGGCGCCAGG + Intergenic
978542957 4:109838392-109838414 CTTTCTGAGCAGTGGTCCTCAGG - Intronic
981127285 4:141121207-141121229 CCTGCTGGGCAGAGAGGGTCTGG - Intronic
985472010 5:52598-52620 TCCTCTGGGCAGTGAGCTTCGGG - Intergenic
991247771 5:64526031-64526053 CTTTCTGTGCAGTGAGCATCAGG - Intronic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
997598997 5:135126790-135126812 TTTCCTGGGCAGTGGGCGGCGGG + Intronic
1001430659 5:171659222-171659244 TCTTCTAGGCAGTGGGGGTGGGG + Intergenic
1003744095 6:8980165-8980187 CCTTATGGGTAGTGGGGCTCAGG + Intergenic
1006474698 6:34246536-34246558 CCTTCTGGGATGGGGGCGGCTGG - Exonic
1007431857 6:41781076-41781098 CCTTCAGGGCAGCGGGTGTTGGG + Intronic
1007775505 6:44222508-44222530 CCTTCGGGTCAGTGGGCATGGGG + Intronic
1010343604 6:74786088-74786110 CCTGTTGGGGAGTGGGGGTCTGG - Intergenic
1011271573 6:85585229-85585251 CCTGCTGGGGAGTGGGGGACTGG + Intronic
1014142167 6:117956298-117956320 CCTTCTGGACAGTGGACATCAGG + Intronic
1015843925 6:137498142-137498164 GCTGCGGAGCAGTGGGCGTCGGG - Intergenic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1018400609 6:163415536-163415558 CCGGCCGGGCAGGGGGCGTCCGG - Intronic
1019414747 7:922120-922142 CCTCCAGGGCTGTGGGAGTCGGG - Intronic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1019693657 7:2432482-2432504 CCTTCTGATCAGTGGGGGACTGG - Intronic
1019911951 7:4106149-4106171 CCTTCTGAGCAGCGAGTGTCTGG - Intronic
1020138378 7:5598996-5599018 GCTTCTGTGCAGTGGGGGTGGGG + Intronic
1022271973 7:28817300-28817322 CCTCCTGCTCAGTGGGCATCAGG + Intronic
1026539474 7:71267858-71267880 CCTGCTGGGAAGTGGGGGTGGGG - Intronic
1028931301 7:96415623-96415645 ACTTATTGGCAGTGGGCATCTGG - Intergenic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1034517701 7:151593562-151593584 CCTTCTGGGGGATGGGCGTGAGG + Intronic
1034998234 7:155591790-155591812 CCTTCTGGGCAGTGTGGCTATGG - Intergenic
1038460686 8:27714080-27714102 CCTTCTGGGGAGGAGGCCTCAGG - Intergenic
1039816343 8:41097910-41097932 CGTTCTGGGAAGTGGGAGACAGG + Intergenic
1041564179 8:59257966-59257988 CCTGTTGGGGAGTGGGGGTCTGG - Intergenic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1049151642 8:141038747-141038769 CCTTCTTGGCAGTGGGCCTTGGG + Intergenic
1049275643 8:141718809-141718831 CCTCCTGGGCTGTGGGGGTCTGG + Intergenic
1049591371 8:143464460-143464482 CCTCCTGGGAAGTGGGTGTGAGG + Intronic
1049616127 8:143576500-143576522 GCTACCGGGCAGTGGGCGTGAGG - Exonic
1049629383 8:143644472-143644494 CTTGCTGGGCAGTGGGAGCCGGG - Intronic
1049629857 8:143647861-143647883 CCCTGTAGGCTGTGGGCGTCTGG + Intronic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1056532197 9:87497824-87497846 CCTTTTGGGCGGAGGGCGGCCGG - Intronic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059415233 9:114158086-114158108 CCGTCTGGGCACAGGGGGTCTGG + Intronic
1059635153 9:116163157-116163179 TATTCTGGGCAGTGGGTGTTGGG + Intronic
1060778146 9:126391845-126391867 CCTTCTCAGCAGGGGGTGTCTGG + Intronic
1062396352 9:136354396-136354418 TCTCCTGGGCTGTGGGGGTCAGG + Intronic
1062398883 9:136363760-136363782 CCATCTTGGAAGTGGGCGCCGGG + Exonic
1185529122 X:803163-803185 CCTTCTGAGCAGGGGGTATCTGG + Intergenic
1190556488 X:51641031-51641053 ACTTCTGTGCAGTGGGGATCTGG - Intergenic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1195065574 X:101235539-101235561 CCATCTGGGCAGTGGTCCTGAGG + Intronic
1196294689 X:113984247-113984269 CCAGCTGGGTAGTGGGCCTCTGG - Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic