ID: 1140211819

View in Genome Browser
Species Human (GRCh38)
Location 16:72976651-72976673
Sequence CTATGTCAACACAATTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140211817_1140211819 -10 Left 1140211817 16:72976638-72976660 CCACTGGGATTCACTATGTCAAC 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG 0: 1
1: 0
2: 2
3: 10
4: 157
1140211816_1140211819 -2 Left 1140211816 16:72976630-72976652 CCACGTGGCCACTGGGATTCACT 0: 1
1: 0
2: 3
3: 4
4: 105
Right 1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG 0: 1
1: 0
2: 2
3: 10
4: 157
1140211810_1140211819 23 Left 1140211810 16:72976605-72976627 CCCCGGTAGAAATGGACTCAGCA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG 0: 1
1: 0
2: 2
3: 10
4: 157
1140211812_1140211819 21 Left 1140211812 16:72976607-72976629 CCGGTAGAAATGGACTCAGCACT 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG 0: 1
1: 0
2: 2
3: 10
4: 157
1140211811_1140211819 22 Left 1140211811 16:72976606-72976628 CCCGGTAGAAATGGACTCAGCAC 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140211819 Original CRISPR CTATGTCAACACAATTATCT GGG Intronic
901247119 1:7740462-7740484 CTATATAAACATAAATATCTAGG + Intronic
901295088 1:8155072-8155094 TTCTGACAACAGAATTATCTAGG - Intergenic
902322238 1:15676042-15676064 CTGATTCAACACAATTATGTTGG - Intergenic
906884755 1:49632271-49632293 CTATGTTAACCCAATTATTATGG + Intronic
910538792 1:88331092-88331114 CTATGCCAACACCTTCATCTTGG + Intergenic
916181642 1:162089067-162089089 GTATTTCAAGACCATTATCTTGG + Intronic
918385146 1:183998703-183998725 CTATGTCTCCACATTTATTTTGG + Intronic
919427831 1:197455664-197455686 CAATTTCAAGTCAATTATCTTGG - Intronic
919901765 1:202048997-202049019 CTATGGCAAAATAATTATTTTGG - Intergenic
921578453 1:216866044-216866066 CTGTGTTAACACAAATATCTGGG - Intronic
921698696 1:218243034-218243056 TTATGTAAACACAATTCTTTTGG + Intergenic
1067280844 10:44871432-44871454 CTATGTTCACACATTAATCTGGG + Intergenic
1068417845 10:56747835-56747857 TGATGCCAACACATTTATCTTGG + Intergenic
1070553765 10:77512795-77512817 CCCTGTCAACACCATGATCTTGG + Intronic
1072298108 10:94031955-94031977 CTACATCATCACAATTATCAGGG - Exonic
1072782568 10:98260497-98260519 TTATGTAAACAGAATTAACTAGG - Intronic
1073856856 10:107686214-107686236 ACCTGTCAACACAATGATCTTGG - Intergenic
1074486268 10:113884879-113884901 CAATGTCTACACAATTCACTAGG - Intronic
1076983695 11:219844-219866 CTATGTAAATACTATTATCTCGG + Intronic
1078945904 11:16068470-16068492 CAATGTCAACAAAATGATCTAGG + Intronic
1081683718 11:45026910-45026932 ATTTTTCAGCACAATTATCTGGG - Intergenic
1082120659 11:48376362-48376384 AGATGGCAACACAATTATATTGG - Intergenic
1082754173 11:57056285-57056307 CTCTGAAAACAAAATTATCTGGG - Intergenic
1085335353 11:75689168-75689190 CTATGTGAAAACAATTCTCTAGG + Intergenic
1086507837 11:87524428-87524450 CTATGTCAAGAAAAATATTTAGG - Intergenic
1086753707 11:90531871-90531893 CTAGGACAACAGGATTATCTGGG + Intergenic
1087785609 11:102350939-102350961 CTTTTTCAAAACAATTACCTTGG - Exonic
1089047289 11:115513325-115513347 CCAGTTCAACTCAATTATCTGGG + Intergenic
1091414793 12:272248-272270 CGATGGCAATACCATTATCTTGG + Intergenic
1094336071 12:29355647-29355669 CTTTATCAAAACACTTATCTAGG + Intronic
1098398071 12:70043434-70043456 CTTTGCCAACACATTTGTCTTGG - Intergenic
1101042773 12:100773353-100773375 CTCTGAGAACACAAATATCTAGG - Intronic
1101511409 12:105396060-105396082 CTAAGGCAACACAATAATTTAGG + Intronic
1106893300 13:34269789-34269811 CTAAGTCAACTCCATTATCTGGG + Intergenic
1107635864 13:42392212-42392234 CAATGTCAAAACCATTAACTGGG - Intergenic
1108131984 13:47311102-47311124 CTATGTCACCAGGAATATCTGGG - Intergenic
1108750610 13:53444632-53444654 CTATGTCATCACCTTTATTTCGG - Intergenic
1110099928 13:71585984-71586006 CCATGACAAAACAATTATGTTGG + Intronic
1110255555 13:73429999-73430021 TAATATCAACACAATTGTCTGGG + Intergenic
1110446900 13:75595102-75595124 CTATGTCAAATCAATTTTATAGG - Intronic
1111213065 13:85105858-85105880 ATAATTCAACAGAATTATCTGGG + Intergenic
1116611865 14:47084827-47084849 CCATGCCAACACACTGATCTTGG + Intronic
1116705120 14:48285967-48285989 GTATGTCAACACAATTCACCTGG + Intergenic
1116890717 14:50265573-50265595 TTATGTCATCACAAAAATCTAGG + Intronic
1121828476 14:97029676-97029698 CAATGTCAAAACAATTACCATGG - Intergenic
1122713332 14:103677114-103677136 CTCTGTCAACAGAAACATCTGGG - Intronic
1123635125 15:22298328-22298350 CTATATCAGCATAATGATCTGGG - Intergenic
1125171716 15:36772802-36772824 CTCTGTTAACACAATTCTTTTGG - Intronic
1127035754 15:54915748-54915770 CCATGGAAACACAATTTTCTGGG - Intergenic
1127569709 15:60230001-60230023 TTATGTCATCAGAATTATCTTGG - Intergenic
1127845619 15:62868042-62868064 CTCTGTCAACACCTTGATCTTGG + Intergenic
1131370871 15:91880789-91880811 CTATTTAAACAGAAGTATCTGGG + Intronic
1131545865 15:93314970-93314992 CTGTGTCAACACCTTGATCTTGG - Intergenic
1138465982 16:57190491-57190513 CTATTTCAAAAGAATTATTTGGG + Intronic
1139935001 16:70563811-70563833 CTATTTCAACACCAGTTTCTGGG + Intronic
1140211819 16:72976651-72976673 CTATGTCAACACAATTATCTGGG + Intronic
1141395254 16:83698898-83698920 CTGTGTCAACACAGTTCTATTGG - Intronic
1151004687 17:70420863-70420885 CTAAGCCAGCACCATTATCTGGG - Intergenic
1155320736 18:24616306-24616328 CTATGTCAAGACCATCTTCTAGG - Intergenic
1155327139 18:24675854-24675876 CTATTCCAACACAATTCTTTGGG - Intergenic
1155573617 18:27221785-27221807 ATATGGCAACACAATAATATTGG - Intergenic
1156147534 18:34203488-34203510 TTATATCAATACAATTATTTTGG + Intronic
1157912219 18:51627279-51627301 GGATGTCAACACAGTTTTCTAGG - Intergenic
1158289186 18:55919532-55919554 CTATTACAACACAACTATCGTGG + Intergenic
1158928713 18:62299025-62299047 CTATCTCATCAGAATTATCTGGG + Intronic
1165875775 19:39005641-39005663 CTATGCCAACACCTTGATCTTGG + Intronic
1168156703 19:54477375-54477397 CTATCTCTACACAGTTAGCTGGG - Intergenic
1168167155 19:54557153-54557175 CTATGTCAAAATAAGTTTCTTGG - Intergenic
926479470 2:13372641-13372663 CTATATCAGCACAATGATCTGGG - Intergenic
938682701 2:133707749-133707771 CTATGTCAGAACAAGAATCTAGG + Intergenic
939480610 2:142742939-142742961 CTATGACAACATCGTTATCTTGG + Intergenic
941743681 2:169063783-169063805 AAATGTCAACACAAGTATTTTGG - Intergenic
942387064 2:175453450-175453472 CTATGTCAAGGTAATAATCTGGG + Intergenic
949004939 2:241640194-241640216 CCATGTCAACACAGTTGTCAAGG - Intronic
1169841751 20:9945442-9945464 GTTTGTCAAAACCATTATCTTGG - Intergenic
1170029347 20:11928940-11928962 CTGTATCAACACAATTATAAGGG - Intergenic
1170054417 20:12184228-12184250 ATATGTCAACAAAATTTTATGGG - Intergenic
1173036312 20:39414413-39414435 CTCGGTCAGCACCATTATCTTGG + Intergenic
1177723859 21:24942392-24942414 CTATTTCATTACAATTATTTGGG - Intergenic
1185135852 22:49071916-49071938 CTTTGTAAACACAGTTGTCTTGG + Intergenic
949762497 3:7486895-7486917 CTATGTCCTCACAAGAATCTAGG - Intronic
951594814 3:24306424-24306446 TTATGACAACCCAATCATCTTGG - Intronic
951782391 3:26378671-26378693 CCATGTCAACACAATTATTTGGG - Intergenic
952651454 3:35732242-35732264 CTTTGTCAGCACAATTGACTTGG + Intronic
952997702 3:38901394-38901416 GGATGACTACACAATTATCTAGG - Intronic
953216460 3:40923251-40923273 CTGTGTCAACACAACTGACTAGG - Intergenic
953607715 3:44422673-44422695 CTGTGTCAACAAAATGAGCTTGG + Intergenic
958194576 3:90227339-90227361 CTATGTGAAAATAAGTATCTAGG + Intergenic
958417938 3:93898374-93898396 CTATGTGAAAATAAGTATCTAGG + Intronic
958590421 3:96151703-96151725 CTAAGTCTTCACAATTAGCTGGG - Intergenic
958780463 3:98535107-98535129 CTATGTCTATAGAATTATCAAGG + Intronic
962360049 3:134732749-134732771 TTATGTCAGGACAATTTTCTTGG - Intronic
966135306 3:176691597-176691619 ATAAGTCCACACAATTATTTAGG + Intergenic
966213991 3:177482356-177482378 CTATCTCAACACAATAATCTAGG + Intergenic
966283701 3:178267592-178267614 CTATGTGATCACACTTATATTGG + Intergenic
970130875 4:12869332-12869354 CTATGTCAAAATCAATATCTGGG + Intergenic
970518465 4:16858741-16858763 CTATCACATCACAATTATTTCGG + Intronic
971741521 4:30527197-30527219 TAATGTCATCACAATCATCTTGG - Intergenic
972068675 4:34986092-34986114 ATATGTCCATACAATAATCTAGG + Intergenic
972292237 4:37700001-37700023 CTATGTCAACACATTTACTGAGG - Intergenic
974008725 4:56587132-56587154 CTATGTAAAAAAAATTATTTAGG - Intronic
974221389 4:58977034-58977056 CTCTGCCAACACACTGATCTTGG - Intergenic
975251730 4:72187330-72187352 CTTTGTTAACATAATTATCATGG + Intergenic
975590422 4:75994189-75994211 CTATGTGGACATAAATATCTTGG + Intergenic
975935264 4:79572132-79572154 CTATATCATCCCATTTATCTTGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
980334045 4:131445459-131445481 CTATGTCAGCACCTTGATCTTGG + Intergenic
980462368 4:133132238-133132260 CTTAGTAAATACAATTATCTGGG + Intergenic
981955080 4:150461705-150461727 CAATGAAAACCCAATTATCTTGG - Intronic
982220732 4:153123048-153123070 CAATGTCAACACAAATATACAGG + Intergenic
982373078 4:154655964-154655986 CTACGTCAACACAATTAAGATGG - Intronic
982914011 4:161181813-161181835 CTTTGTCAAAAGAATTACCTGGG - Intergenic
983736872 4:171072598-171072620 CTATATTAACAAGATTATCTTGG + Intergenic
987444818 5:18004734-18004756 TGGTGTAAACACAATTATCTTGG - Intergenic
987729426 5:21749275-21749297 CTCTGTCAACACCTTGATCTTGG + Intergenic
987830224 5:23085989-23086011 CTCAGCCAACACCATTATCTAGG - Intergenic
988471731 5:31545746-31545768 CTTTGTAAAGACAATTTTCTGGG + Intronic
989246163 5:39257379-39257401 CTAAGTCAAAATAAGTATCTTGG - Intronic
990100106 5:52172905-52172927 CTATGTCAAAAAAATTTTTTTGG + Intergenic
992136054 5:73747175-73747197 TTATGCCAACAAATTTATCTAGG + Intronic
998984823 5:147744743-147744765 CTATATCCACACAAGGATCTGGG - Intronic
1002951056 6:1811824-1811846 CAATGTCCACAGAATTCTCTTGG + Intronic
1004788708 6:18999045-18999067 TTATGCCCACACAATTTTCTTGG - Intergenic
1005895340 6:30172683-30172705 CTGTTTCAAAATAATTATCTTGG + Exonic
1007291349 6:40789455-40789477 CTATGTCATTACTATTATTTAGG - Intergenic
1007885157 6:45219652-45219674 CAATTCCAAAACAATTATCTAGG + Intronic
1007902830 6:45426357-45426379 CTTTGTCACTAGAATTATCTAGG - Intronic
1008445358 6:51583143-51583165 ATGTGTCTACACTATTATCTTGG - Intergenic
1009277853 6:61706601-61706623 TTATGTGATCACAATTGTCTAGG - Intronic
1009467465 6:63990068-63990090 CTTTGTGAACACATTGATCTAGG + Intronic
1009831229 6:68938642-68938664 ATATGTAATCACAGTTATCTAGG - Intronic
1010038018 6:71348192-71348214 GTTTGTCAGCACAATAATCTGGG - Intergenic
1010374839 6:75155672-75155694 CTATGACAACACAGTTGTTTTGG - Exonic
1010889610 6:81290413-81290435 CTATTTCAACACAGTAAACTTGG - Intergenic
1011040540 6:83025346-83025368 AAATGTAAACACAATCATCTTGG + Intronic
1011451272 6:87495128-87495150 CCATGTCTACAAAATTAGCTGGG - Intronic
1012553595 6:100486711-100486733 CTAAGTGAACACAATCATCTTGG + Intergenic
1012781346 6:103561788-103561810 CTATCTCCACACTATTATGTAGG - Intergenic
1015434926 6:133174101-133174123 ATATGTGAAAACATTTATCTAGG + Intergenic
1015487856 6:133791777-133791799 CCATGTCAGGACAATCATCTGGG + Intergenic
1015571616 6:134626870-134626892 CAAAGTGAACACTATTATCTTGG + Intergenic
1027495779 7:78886505-78886527 CCATGTCTCCACAAATATCTAGG + Intronic
1027507117 7:79030229-79030251 CTATGTGAACACAGAAATCTTGG - Intronic
1027733038 7:81900418-81900440 CTATGGCAACACAATAATAGTGG - Intergenic
1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG + Intronic
1032372564 7:131372984-131373006 CTATGTATAAACCATTATCTTGG - Intronic
1033762380 7:144449565-144449587 CTATCTCAAAACAATTCTCCAGG - Intergenic
1033762900 7:144455811-144455833 CTATGTCATTACAATTATTTTGG + Intronic
1038838297 8:31153331-31153353 CTATGGCAACACCATGGTCTAGG - Intronic
1039276239 8:35936239-35936261 CTATGACAAGTCAAATATCTAGG + Intergenic
1040943750 8:52859269-52859291 TTTTGTGAACACTATTATCTTGG + Intergenic
1043327947 8:79076239-79076261 ATATGTCAAGACAAAGATCTAGG + Intergenic
1044572556 8:93735816-93735838 CTATGGCATCACCATTATTTCGG + Exonic
1046272429 8:111914493-111914515 CTAAGCCAACATCATTATCTAGG + Intergenic
1046603808 8:116348557-116348579 ATATGTCTCCACAATTCTCTGGG + Intergenic
1046682588 8:117186911-117186933 CTTTTTCAACACAATAAACTAGG - Intergenic
1047825850 8:128574232-128574254 ATATGTCAAGATAAATATCTTGG + Intergenic
1048894542 8:138978623-138978645 CTGTATCAAAACAATTATGTCGG - Intergenic
1050443424 9:5690240-5690262 CTATATCAAGACTATTTTCTTGG + Intronic
1052152675 9:25138049-25138071 CTGTGTCAACACAATGATTATGG - Intergenic
1056272977 9:84965273-84965295 CTATGTCTGCAAAACTATCTTGG - Intronic
1187739894 X:22344256-22344278 CTATTTCCAGACAATCATCTGGG - Intergenic
1190043025 X:47086986-47087008 CTAAGTCCACACAAATATCCTGG + Intronic
1193819074 X:86140239-86140261 CTTAGACAAAACAATTATCTTGG - Intergenic
1194416842 X:93624047-93624069 AACTGTCAACAGAATTATCTAGG + Intergenic
1194863774 X:99039522-99039544 CTATATAAACACAATTTTATGGG - Intergenic
1194940708 X:100006473-100006495 ATACGTCAACATAATTATCAAGG - Intergenic
1198512806 X:137371259-137371281 CTCTGTCAACACCTTGATCTTGG - Intergenic
1202360702 Y:24107177-24107199 TTATGTGCACACAATTGTCTAGG + Intergenic
1202510076 Y:25562941-25562963 TTATGTGCACACAATTGTCTAGG - Intergenic