ID: 1140213329

View in Genome Browser
Species Human (GRCh38)
Location 16:72987827-72987849
Sequence ATTCATGAAAGGCAGTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140213329_1140213335 5 Left 1140213329 16:72987827-72987849 CCCTAGGACTGCCTTTCATGAAT 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1140213335 16:72987855-72987877 GCTCCTAGGCAAAGTGGCAAAGG 0: 1
1: 0
2: 0
3: 18
4: 145
1140213329_1140213332 -9 Left 1140213329 16:72987827-72987849 CCCTAGGACTGCCTTTCATGAAT 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1140213332 16:72987841-72987863 TTCATGAATCACCTGCTCCTAGG 0: 1
1: 0
2: 0
3: 14
4: 179
1140213329_1140213333 -1 Left 1140213329 16:72987827-72987849 CCCTAGGACTGCCTTTCATGAAT 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1140213333 16:72987849-72987871 TCACCTGCTCCTAGGCAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140213329 Original CRISPR ATTCATGAAAGGCAGTCCTA GGG (reversed) Intronic
905636734 1:39559009-39559031 ATTCTTCAAAAGCAGTCCAATGG + Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
906728245 1:48059542-48059564 ATTCATGAAAAGCAGAGTTAGGG - Intergenic
907269445 1:53282257-53282279 ACTCATGAAATGCATTCCTAGGG - Intronic
909365903 1:74821667-74821689 ATTCAGCAAAGGAAGTCATAAGG + Intergenic
911751022 1:101498335-101498357 ATTCATAGAAGGAGGTCCTAGGG + Intergenic
917023809 1:170619504-170619526 ATTCAGGAAATTCAGTCATATGG + Intergenic
917943882 1:179949804-179949826 ATTAACTAAAGGCATTCCTAAGG - Intergenic
920626225 1:207603439-207603461 ATTCCAGACAGGGAGTCCTAGGG - Intronic
924700365 1:246445405-246445427 ATTCATGGAAGGCAATTTTAGGG - Intronic
1064349624 10:14565334-14565356 TTTGATGAAATGCAGTCCAAGGG + Intronic
1066016741 10:31253169-31253191 ATACAGGGAAGGCAGTGCTATGG - Intergenic
1066293474 10:34034630-34034652 ATTCATCAAACGCTTTCCTATGG + Intergenic
1068059852 10:52053356-52053378 ATTAATGAAAGGCAATTTTAAGG + Intronic
1068841436 10:61619221-61619243 CTTCATGCCAGGCAGTCCAAAGG - Intergenic
1069599980 10:69697886-69697908 CTTCATGAAAGGAACTCTTAAGG - Intergenic
1070867828 10:79718449-79718471 AATCATGAAAGGACATCCTAAGG - Intergenic
1071634741 10:87240650-87240672 AATCATGAAAGGACATCCTAAGG - Intergenic
1072324646 10:94285902-94285924 ATTAATGAATGGTAGACCTATGG + Intronic
1073581641 10:104672602-104672624 ATGCAGCAAAAGCAGTCCTAAGG - Intronic
1076079956 10:127570347-127570369 ATTCATGGAAGACAATCCCATGG + Intergenic
1076336749 10:129712060-129712082 GTTCAAGAAAAGCAGACCTACGG + Intronic
1077745856 11:4904386-4904408 TTTCAAGGAAGGCAGTCCTCAGG - Intronic
1078258179 11:9678926-9678948 TTTCATGAAACGCAGTCTTGGGG - Intronic
1079384973 11:19970899-19970921 ATTCATGATAGGCAGTTTCATGG - Intronic
1080114434 11:28606392-28606414 GTTCAGGATGGGCAGTCCTAAGG - Intergenic
1080252814 11:30254370-30254392 ATTCATCAAAGCCAGTCTTATGG - Intergenic
1082266004 11:50119129-50119151 ATTCACCAAAGGGAGTGCTATGG - Intergenic
1082290084 11:50359443-50359465 ATTCACCAAAGGGAGTGCTATGG + Intergenic
1085756131 11:79202718-79202740 ATTCATGAAGAGCAGTGCTCTGG + Intronic
1089933205 11:122335215-122335237 AGTGATGAAAAGCAGTCCTCTGG - Intergenic
1089986899 11:122823301-122823323 ATTCTTATCAGGCAGTCCTATGG - Intergenic
1097700503 12:62815098-62815120 CTTCATGAAAGACCTTCCTAGGG + Intronic
1101195058 12:102373206-102373228 CTTCATGAAGGGAAGACCTAAGG + Intergenic
1101618451 12:106360467-106360489 AATCAGGAAAGGCCTTCCTAGGG - Intronic
1102431918 12:112890460-112890482 ATTCTTAAAGGGCAGTCCTTGGG - Intronic
1104524359 12:129504865-129504887 ATACAGCAAAGGCAGTGCTAAGG - Intronic
1114589091 14:23843184-23843206 GTTCATGAATGGCAGTTCCAAGG + Intergenic
1115963791 14:38864635-38864657 ATTGATGAAAGTTTGTCCTAGGG - Intergenic
1117098067 14:52317119-52317141 ATTCCTGAAAGACTGTCTTAGGG + Intronic
1117823668 14:59677844-59677866 AGTCATGAAAGGCAGTAATGTGG + Intronic
1119943116 14:78662366-78662388 ATACATGAAGGACTGTCCTATGG + Intronic
1120545509 14:85806794-85806816 ATACAGCAAAGGCAGTGCTAAGG - Intergenic
1121486564 14:94321019-94321041 ATTCATACATGGCAGTGCTAGGG - Intronic
1123151722 14:106187716-106187738 ATCCATGAAGGGGAGTCCTGAGG - Intergenic
1123400118 15:19975596-19975618 ATCCATGAAGGGGAGTCCTGAGG - Intergenic
1124091028 15:26600700-26600722 ATTCCTGTAAGGCAGAGCTAGGG - Intronic
1125264956 15:37868014-37868036 ATTCATCAAAGGCGGAGCTATGG - Intergenic
1126733794 15:51711478-51711500 ATTCATTAAAGTGAGCCCTATGG + Intronic
1133055276 16:3142699-3142721 GTTCATGGAAGGCAGTGCTCAGG - Exonic
1133448960 16:5887345-5887367 ATCCATTGAAGGCAGTACTATGG - Intergenic
1137419075 16:48315671-48315693 ATTCAAGAAAGTCAGTGCTATGG - Intronic
1138813853 16:60181890-60181912 TTTCTTGAAAGGCAGTCTTGGGG - Intergenic
1140213329 16:72987827-72987849 ATTCATGAAAGGCAGTCCTAGGG - Intronic
1148840830 17:50495688-50495710 TTCCTTGCAAGGCAGTCCTAAGG + Intergenic
1149290954 17:55216940-55216962 ATTCATGAAAGGGAGGCATAAGG - Intergenic
1150187561 17:63200500-63200522 ATTAATGAATGGCAGTGATAGGG + Intronic
1155103106 18:22633385-22633407 ACACATGAAAGGGAGGCCTAAGG + Intergenic
1156567760 18:38215040-38215062 ATTCATGAAAGGCATTGTTATGG + Intergenic
1157946512 18:51986842-51986864 ATTAAGGACAGGCAGTCCTTGGG - Intergenic
1158830077 18:61267083-61267105 ATACAGCAAAGGCAGTGCTAAGG + Intergenic
1159649896 18:70965687-70965709 ATTGATCAAAGGAAGTCCCAAGG - Intergenic
1162612269 19:11766053-11766075 ATTCCTGAAATGGAGCCCTAGGG - Intergenic
1168125927 19:54282854-54282876 ACTCATGAAACCCAGTCCTCTGG - Intergenic
925220032 2:2131653-2131675 ATTCATGACAAGCTGTCCCATGG + Intronic
929305036 2:40351699-40351721 ATTGAAGAAAGGCAGTGATAGGG + Intronic
929917379 2:46147476-46147498 TTTCATGAAAAGCAGTCCATTGG + Intronic
931523369 2:63125333-63125355 ATTCACTAAAGGCATTCCTGTGG - Intronic
933800558 2:85957064-85957086 ATTTATGAAATGCAATCCTTTGG + Intergenic
934538619 2:95157350-95157372 ATTCCTGAAAGCCAGGCCTCGGG - Exonic
935591785 2:104851909-104851931 ATTAATGAAAGGCGGCCCCATGG + Intergenic
945606062 2:211933154-211933176 ATGCTTCAAATGCAGTCCTATGG - Intronic
947272244 2:228348928-228348950 TTTGATTAAAGGCAGTCCTGTGG + Intergenic
1168786888 20:547221-547243 ATCGATCAAAGGCAGTCATATGG + Intergenic
1169351912 20:4874953-4874975 ATTTAGGAAAAGCTGTCCTAAGG - Intronic
1172633137 20:36392323-36392345 ATGAATGACAGGCAATCCTAAGG - Intronic
1175488781 20:59364720-59364742 ATGCATGAGAGGCAGTGCTGTGG + Intergenic
1181364220 22:22362609-22362631 ATACAGCAAAGGCAGTGCTAAGG - Intergenic
1183789356 22:40052767-40052789 CTTCAAGAAACTCAGTCCTATGG - Intronic
950569076 3:13788887-13788909 AGTCACGGAAGGCTGTCCTAGGG + Intergenic
951306157 3:21065528-21065550 ATTCCTGAAAGGCAAGCCCATGG + Intergenic
952589610 3:34934557-34934579 AGTCATGAAAGTCAGACCTTTGG - Intergenic
952644770 3:35641538-35641560 TTTCATGAAAGACAGTCATTTGG + Intronic
954717160 3:52532668-52532690 AAGCATGAAACGCAGTCCTGGGG - Intronic
954738543 3:52727881-52727903 ATTCAGCAAAAGCAGTGCTAAGG + Intronic
957527318 3:81393808-81393830 ATGCATGAAATGCAGTTGTACGG + Intergenic
962369132 3:134806196-134806218 ATTCATTACAGTGAGTCCTAAGG - Intronic
965841981 3:172916667-172916689 ATACATAAAAGGGAGTCCTTTGG + Intronic
966042892 3:175513515-175513537 GTTCATGATAGGCAATACTATGG + Intronic
967189835 3:186975712-186975734 ACCCATGAAAGGCAGTGCCAGGG + Intronic
968341091 3:197956432-197956454 ACTCATAAAAAGCAATCCTATGG + Exonic
970005313 4:11405273-11405295 ATTCATGAAACTCAGGCCTTGGG - Intronic
971820860 4:31553030-31553052 ATTCATCAAAGCAAGTCATAAGG + Intergenic
975227272 4:71888792-71888814 ATTGATGAAAAGATGTCCTATGG + Intergenic
977296117 4:95211341-95211363 ATTTATGAAAGCCACTCCGAAGG + Intronic
977415437 4:96726898-96726920 ATTCAGGAAAGTCTGTGCTATGG + Intergenic
978647744 4:110959196-110959218 ATTCCTTAAATGCAGTGCTAAGG + Intergenic
979498884 4:121416297-121416319 ATACAGCAAAGGCAGTGCTAAGG - Intergenic
980460230 4:133100949-133100971 ATTAATGAAAGGAAATCATATGG + Intergenic
981433175 4:144686321-144686343 ATTCATGAGAAGCAGTCTTTGGG + Intronic
981777769 4:148389783-148389805 ATTCATAAAAGGCATTCTTTTGG + Intronic
982051996 4:151511277-151511299 ATTCATGAAATGCAATCCCGAGG + Intronic
986804288 5:11293986-11294008 GTTCCTGGAAGGCAGTCCTGGGG - Intronic
987218374 5:15763541-15763563 TTTCATCAAAGGAATTCCTATGG - Intronic
989336098 5:40318671-40318693 ATTCATTTAAAGCAGACCTAAGG - Intergenic
990361168 5:55021446-55021468 GTTGAAGAAAGGCAGTCCAAGGG + Intronic
992489967 5:77233278-77233300 ATTGATGAAGGCCAGTCATATGG + Intronic
994186140 5:96817202-96817224 ATTCCTGCTAGGCAGTCCCAGGG + Intronic
995537300 5:113150066-113150088 CTTCCTGGAAGGCAGTCCTGAGG - Intronic
995725668 5:115178886-115178908 ATTCATGCCCGACAGTCCTATGG - Intronic
996248036 5:121289584-121289606 AATCAGGAAAGCCAGTTCTAGGG + Intergenic
1000920312 5:167129920-167129942 GTTCATAAAAGGCAGTACCAGGG + Intergenic
1001339934 5:170833993-170834015 AGACAGGAAAGGCAGTGCTAGGG - Intergenic
1001701785 5:173712062-173712084 GTTCATAAAAGGCTGTCCTTGGG - Intergenic
1003043304 6:2709517-2709539 ATTCATGAACCTCAGTCCTGGGG - Intronic
1005704746 6:28440267-28440289 GATCATGAAAGGCAGTGGTAAGG + Intronic
1008676351 6:53823396-53823418 ACTCATGAAAAGTAGTGCTAGGG + Intronic
1009931153 6:70178962-70178984 ATTGATGGAAGTCATTCCTAAGG - Intronic
1012571046 6:100729502-100729524 ATACATAAAATGGAGTCCTAAGG + Intronic
1013862360 6:114651098-114651120 ATGCATGAAAGGAATTCCAAGGG + Intergenic
1014932503 6:127350722-127350744 TTTCATGTAAGGCAGGTCTATGG - Intergenic
1021751605 7:23806444-23806466 ATTCCTGAGAGGCACTGCTAAGG - Intronic
1024657497 7:51464083-51464105 ATTCATGAAAATCAGCCCTATGG - Intergenic
1030381474 7:108816311-108816333 CTTCATGAAAGGCACAACTATGG - Intergenic
1032143236 7:129353442-129353464 AATCAAGAAAGGCAGTTTTAAGG - Intronic
1034050022 7:147973225-147973247 ATTCATGAAAGGCAGTAAAGTGG - Intronic
1034410411 7:150938440-150938462 ATGCCTTAAAGGCAGTCCTGAGG - Intergenic
1035466968 7:159085792-159085814 ATTCTGGAAAGGCAGGACTATGG + Intronic
1036020228 8:4836460-4836482 ATTCAAGAGCGCCAGTCCTATGG - Intronic
1037516964 8:19641685-19641707 ATGCATTTAAGGCAGTCTTATGG - Intronic
1039593893 8:38773889-38773911 ATTTATGAAAGACAATACTATGG + Intronic
1045667742 8:104508383-104508405 ACAAATGAAAGGCATTCCTAGGG - Intronic
1046656040 8:116895789-116895811 ATACATCAAAAACAGTCCTAAGG + Intergenic
1047355404 8:124116890-124116912 ATTGATGAAAGGCAGAGTTAAGG - Intronic
1050391136 9:5145694-5145716 ATTTAAGAAAGGCAGTCTTCAGG + Intronic
1051275873 9:15397804-15397826 TTTCATTAAATGCAATCCTAAGG + Intergenic
1051705592 9:19876556-19876578 ATTCAGTAAAAGCAGTTCTATGG - Intergenic
1052140899 9:24981845-24981867 ATCTATGAAAGGCAGACCTCAGG - Intergenic
1052393604 9:27910737-27910759 AATCATGAAAGCCATTCCTATGG + Intergenic
1053437969 9:38089829-38089851 GGACATGAAAGGCAGTCCTCAGG - Intergenic
1056895530 9:90544995-90545017 TTTTATGAAAGGCAGTGCTCAGG - Intergenic
1187583701 X:20636916-20636938 ATTCAAGAAAATCAGTCCTTGGG - Intergenic
1188280491 X:28262049-28262071 TTTCTTGAAAAGCAGTTCTATGG - Intergenic
1190360009 X:49639915-49639937 ATTCACGAAGGGCTGTTCTATGG - Intergenic
1192311836 X:70022887-70022909 ATTAATGGAATGCTGTCCTAAGG + Intronic
1192987068 X:76411284-76411306 ATACAGCAAAGGCGGTCCTAAGG + Intergenic
1196785502 X:119418394-119418416 CTTCATGACAGGCAGTGCAATGG - Intronic
1198005985 X:132493050-132493072 ATTCAGGCAAGGCCGTGCTATGG + Intergenic
1198685453 X:139223523-139223545 ATTCATAAGAGGCAGTTCTCTGG + Intergenic
1201558974 Y:15294742-15294764 ATTCCTGAGAGGCAGTCATTTGG + Intergenic
1202305785 Y:23469086-23469108 TTTGCTGAAAGTCAGTCCTATGG - Intergenic
1202565024 Y:26201503-26201525 TTTGCTGAAAGTCAGTCCTATGG + Intergenic