ID: 1140214392

View in Genome Browser
Species Human (GRCh38)
Location 16:72995678-72995700
Sequence CCGCCCACAAACCCCGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140214387_1140214392 16 Left 1140214387 16:72995639-72995661 CCATGGATGTGGCATGGTGTGCA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1140214392 16:72995678-72995700 CCGCCCACAAACCCCGCGCTGGG 0: 1
1: 0
2: 1
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140214392 Original CRISPR CCGCCCACAAACCCCGCGCT GGG Intronic
902870726 1:19312243-19312265 CCGCCCCCACGCCGCGCGCTGGG - Intergenic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903828359 1:26160775-26160797 CCGCCCCCAAACACCGAGGTCGG - Intronic
906399022 1:45491182-45491204 CCGCCCCCAACCCCCCTGCTGGG - Intergenic
909013003 1:70354904-70354926 CCGCCCACAAAAAGCGCGGTTGG - Exonic
918557259 1:185817436-185817458 CCCCTCACACACCCCGCCCTGGG - Intronic
1067848612 10:49741070-49741092 GCGCCCACACACCACGCACTGGG + Intronic
1070951645 10:80436040-80436062 CCGCCCCCAACCCCCGCACCAGG - Exonic
1074391324 10:113060557-113060579 CTGCCTGCAAACCCCTCGCTTGG - Intronic
1077300478 11:1844300-1844322 CTGCCCACAACCCCTGCCCTGGG - Intergenic
1079752157 11:24212926-24212948 CTGCCCACAGACCCCTGGCTGGG - Intergenic
1083305916 11:61761953-61761975 CCGCCTACACACACCCCGCTGGG - Intronic
1097253785 12:57656331-57656353 GCATCCACAAACCCCGAGCTAGG - Intergenic
1102341525 12:112125687-112125709 TCGCCCACACACCCCTCCCTTGG - Exonic
1122784476 14:104157510-104157532 CCGCCCACACACCCCGAGCTGGG + Intronic
1124286353 15:28403161-28403183 CCGCCCGGGAACCCGGCGCTCGG - Intergenic
1132556141 16:573465-573487 CCTCCCACAAGCCCCTCCCTGGG - Intronic
1136556559 16:31010654-31010676 CCGCCCCCCTCCCCCGCGCTCGG - Intergenic
1137557963 16:49484592-49484614 CCGCGCACCAACCCCAGGCTGGG + Intergenic
1140214392 16:72995678-72995700 CCGCCCACAAACCCCGCGCTGGG + Intronic
1144626602 17:16847163-16847185 CCCCACACACACCCCGAGCTGGG + Intergenic
1144879830 17:18425548-18425570 CCCCACACACACCCCGAGCTGGG - Intergenic
1145152404 17:20518836-20518858 CCCCACACACACCCCGAGCTGGG + Intergenic
1146187256 17:30731931-30731953 CCTCCCCCGGACCCCGCGCTGGG - Intergenic
1146332298 17:31937292-31937314 CCTCCCCCGGACCCCGCGCTGGG - Exonic
1147580743 17:41625850-41625872 CCCCACACACACCCCGAGCTGGG + Intergenic
1152831172 17:82497658-82497680 GCGCCCACACCCCCCGCGCTCGG + Intergenic
1160940248 19:1617501-1617523 CCACCCCCAAAACCCGGGCTTGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1167169212 19:47820024-47820046 CCTCCCCCAAACCCCCTGCTAGG - Intronic
1167504737 19:49865306-49865328 CCACCCACTGACCCTGCGCTGGG - Exonic
930007016 2:46906102-46906124 CAGCCCACTAACCCTGCTCTTGG - Intronic
934839890 2:97618084-97618106 CCTCCCACAGACCCAGAGCTTGG - Intergenic
942911027 2:181244779-181244801 CCGCCCCCAACCCCCGCCCCTGG + Intergenic
948479584 2:238241100-238241122 CCGCCCACGCACCCCGCCCGCGG - Intergenic
948738263 2:240025215-240025237 CCGCCCGCTCACCACGCGCTGGG + Exonic
949056866 2:241932513-241932535 CCACCCCCAAACCCCGCCCCAGG - Intergenic
1170582661 20:17710872-17710894 CTGCCCACACACCCAGCCCTGGG - Intronic
1173063448 20:39684038-39684060 CTGCCCACAAAGCCCAGGCTGGG - Intergenic
1176062730 20:63179295-63179317 CCGCCCCCAAAGCCGGCTCTGGG + Intergenic
949540235 3:5026741-5026763 CTCCCCCCACACCCCGCGCTGGG - Intergenic
954716441 3:52529109-52529131 CCACCAACAAACCCAGGGCTTGG - Intronic
961858270 3:129893746-129893768 CCGCCCACAACCTCCGCCCCCGG + Intergenic
962240943 3:133750431-133750453 CTTCCCTCAATCCCCGCGCTGGG + Intronic
966872303 3:184299068-184299090 CCGCCCTCGGACCCCGCCCTCGG - Exonic
976719850 4:88158939-88158961 CCGCCCGCGAACCCCGACCTGGG - Intronic
977104716 4:92866810-92866832 ACGCCTACAATCCCCGCACTTGG - Intronic
985737896 5:1595032-1595054 CCGCCCGTAATCCCCGCACTTGG - Intergenic
1005428266 6:25726718-25726740 CGGCCCTCAAACGCCGCGTTCGG - Intergenic
1005943420 6:30578351-30578373 CCGCCCCAAAACCCCGCGGAGGG + Exonic
1012887487 6:104861646-104861668 CTGCCCACAAACTCCAGGCTTGG - Intergenic
1017906278 6:158759285-158759307 CCGCCCACAGACCCGCCCCTGGG + Intronic
1018464090 6:164027378-164027400 GCCCCCACAATCCCCGCGCATGG - Intergenic
1019325530 7:436537-436559 CCGCCCACAACCACCGAGATCGG + Intergenic
1019347464 7:538045-538067 CCGCCCACAACCACGGAGCTGGG - Intergenic
1019597187 7:1863617-1863639 CTGCCCACACCCCACGCGCTGGG + Intronic
1020091607 7:5345233-5345255 GCCCCCACAAACCCCAGGCTGGG + Intronic
1025664409 7:63574678-63574700 CCGCCCACCACCCCTGCCCTGGG + Intergenic
1035387678 7:158485104-158485126 CGACCCACAAGCCCTGCGCTCGG - Intronic
1045277907 8:100722887-100722909 CTGCCCCCCAACCCCGCGCCGGG - Intergenic
1061484364 9:130912887-130912909 CCCCCCACACACCCCAGGCTTGG + Intronic
1062341056 9:136094237-136094259 CCTCCCCCAACCCCCGCGCGGGG - Intronic
1185750867 X:2609072-2609094 CCGCCCACAAGCCCGTCGCCAGG - Intergenic
1190285338 X:48957589-48957611 CCCCCAACAAACCCGGCGCGGGG + Exonic
1192944367 X:75949662-75949684 CTGTCCACAAACCCCTGGCTGGG + Intergenic
1200309449 X:155062755-155062777 CCCCCCGCCAACCCCGCCCTTGG - Intronic