ID: 1140219548

View in Genome Browser
Species Human (GRCh38)
Location 16:73033636-73033658
Sequence CTGTGAAAGTGTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 811}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140219548_1140219551 -3 Left 1140219548 16:73033636-73033658 CCTTCCACCTCACACTTTCACAG 0: 1
1: 0
2: 3
3: 63
4: 811
Right 1140219551 16:73033656-73033678 CAGTTTTTTTCCTGCCTGCCAGG 0: 1
1: 0
2: 2
3: 25
4: 291
1140219548_1140219556 15 Left 1140219548 16:73033636-73033658 CCTTCCACCTCACACTTTCACAG 0: 1
1: 0
2: 3
3: 63
4: 811
Right 1140219556 16:73033674-73033696 CCAGGAGGCCAGCCTGTTAAAGG 0: 1
1: 0
2: 1
3: 18
4: 176
1140219548_1140219552 0 Left 1140219548 16:73033636-73033658 CCTTCCACCTCACACTTTCACAG 0: 1
1: 0
2: 3
3: 63
4: 811
Right 1140219552 16:73033659-73033681 TTTTTTTCCTGCCTGCCAGGAGG 0: 1
1: 0
2: 2
3: 35
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140219548 Original CRISPR CTGTGAAAGTGTGAGGTGGA AGG (reversed) Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901547735 1:9971717-9971739 CTTTGAGAGACTGAGGTGGAAGG + Intronic
902138958 1:14335444-14335466 CTTTGGAAGGCTGAGGTGGACGG - Intergenic
902257048 1:15196426-15196448 ATGTGAAAGAGAGAGGGGGAGGG + Intronic
902321730 1:15672440-15672462 CTTTGAAAGTCTGAGGTGGGCGG + Intergenic
902748376 1:18488845-18488867 CTGAGAAAATGCGAGATGGAGGG + Intergenic
902974688 1:20080336-20080358 CTTTGGGAGTGTGAGGTGGGTGG + Intronic
903143887 1:21357416-21357438 GTGTGAAAGGCTGAGGTGGGAGG - Intergenic
903411541 1:23147528-23147550 CTTTGGAAGACTGAGGTGGAAGG + Intronic
903495321 1:23762568-23762590 ATGTGAAAGGCTGAGGTGGGAGG + Intergenic
903765953 1:25734370-25734392 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
904172616 1:28602083-28602105 CTGTGAGACTGTGAAGTGGGGGG + Intronic
904545260 1:31265371-31265393 CTCTGAGAGGCTGAGGTGGAAGG - Intronic
904549736 1:31305683-31305705 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
905007932 1:34725996-34726018 CAGTGAAAGTATAAGGTGGTTGG - Intronic
905790585 1:40787143-40787165 CTGTGAGAGGCTGAGGTGGGAGG + Intronic
905915468 1:41681587-41681609 CTGTGAAAGAATGTGGTGCAAGG - Intronic
906524636 1:46487123-46487145 CTGTGAAAGTGTGTGGGGGTAGG + Intergenic
907006876 1:50923173-50923195 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
907128447 1:52073607-52073629 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
908808184 1:67952224-67952246 CTGTGAAAGTGTGAGGAGATGGG - Intergenic
909099313 1:71331574-71331596 CTGTGAATCTGTGAAGTGAAAGG + Intergenic
909264812 1:73543294-73543316 CTGTGAAAGTATGCGTTGGATGG - Intergenic
909498861 1:76310863-76310885 CTGTCAAGGAGTCAGGTGGAAGG - Intronic
909527147 1:76638070-76638092 CTTTGGGAGGGTGAGGTGGATGG - Intergenic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
909773118 1:79451042-79451064 CTTTGAAAGGCTGAGGTGGATGG + Intergenic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910770575 1:90827150-90827172 CTGTGAAAGTTGGAGTTTGAGGG + Intergenic
911302017 1:96186028-96186050 CTTTGGAAGTCTGAGGTGGGAGG - Intergenic
911688793 1:100807913-100807935 TTCTGAAAGTGTCTGGTGGAGGG + Intergenic
911745201 1:101434358-101434380 CTGTGCAAGTGTTTGGTGGGTGG + Intergenic
911828863 1:102524773-102524795 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
912340176 1:108906895-108906917 CTTTGAAAGGCTGAGGTGGCAGG - Intronic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
913378372 1:118181870-118181892 CTTTGAAAGCCCGAGGTGGAAGG + Intronic
913417619 1:118629156-118629178 CTGTGAGAGTGTGAGATGTTGGG + Intergenic
914312711 1:146481194-146481216 CTTTGGAAGGATGAGGTGGACGG + Intergenic
914501637 1:148252144-148252166 CTTTGGAAGGATGAGGTGGACGG - Intergenic
915328218 1:155092217-155092239 CTGGGGAAGTGTGACGCGGATGG + Intergenic
915478248 1:156167119-156167141 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
916044533 1:160989542-160989564 CTTTGGAAGGCTGAGGTGGAAGG - Intergenic
916284530 1:163091269-163091291 CTGTGAAACTGTGATCTAGAGGG - Intergenic
916390610 1:164326714-164326736 ATGTAAAAGTTTCAGGTGGATGG - Intergenic
916518056 1:165538480-165538502 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
916626706 1:166565859-166565881 ATGTGAATGTATGAGGTAGAAGG + Intergenic
916834445 1:168529248-168529270 CTTTGAAAGACTGAGGTGGGAGG + Intergenic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917853965 1:179087085-179087107 GGGGGAAAGTGTGAGGTGCAGGG - Intronic
918579949 1:186114500-186114522 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
919016169 1:192039438-192039460 CTTTGAGAGGCTGAGGTGGACGG - Intergenic
919116583 1:193287232-193287254 CTGTGAAAGAATGAAATGGAGGG + Intergenic
919667607 1:200307086-200307108 CTGTGAAAGTATGAGAAGCATGG - Intergenic
919781528 1:201224392-201224414 CTGTAGAGGTGTGACGTGGAGGG + Intronic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920747546 1:208643357-208643379 CTGTGAAATTGTAAAGTGAAGGG - Intergenic
922224231 1:223631427-223631449 CTGGGGAGGTGTGAGGAGGAAGG - Intronic
922444923 1:225689102-225689124 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
922656882 1:227392878-227392900 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
923115644 1:230935238-230935260 CAGAGACAGTGTGAGGTGCAGGG + Intronic
923132429 1:231088163-231088185 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
923344985 1:233042921-233042943 AGGTGAAATCGTGAGGTGGAAGG + Intronic
923873810 1:238025159-238025181 CCTTGTAAGTGTGAGGTAGAGGG - Intergenic
924098411 1:240578539-240578561 CTTTGTGAGTCTGAGGTGGATGG + Intronic
924532325 1:244903930-244903952 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
924906947 1:248465161-248465183 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1062845898 10:704825-704847 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1062997259 10:1878495-1878517 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1063234606 10:4099950-4099972 CTTTGGGAGGGTGAGGTGGAGGG - Intergenic
1063344320 10:5296987-5297009 CAGTGAAAGTTAGAGGTGGCAGG - Intergenic
1063724466 10:8621707-8621729 CAGTGAGAGTGTGAGGAGCAGGG - Intergenic
1063985470 10:11497164-11497186 CTTTGGAAGGGTGAGGTGGGGGG + Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064308356 10:14188659-14188681 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1064430537 10:15266620-15266642 CTGTGGAAGGCTGAGGTGGGCGG + Intronic
1064469692 10:15623440-15623462 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1064475354 10:15682609-15682631 CTTTGAAAGGCTGAGGCGGATGG + Intronic
1064509782 10:16077311-16077333 CTGTGAGGGGCTGAGGTGGAAGG + Intergenic
1064539880 10:16394669-16394691 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1065491088 10:26282184-26282206 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
1065721511 10:28632356-28632378 CTTTGAAGGGTTGAGGTGGATGG - Intergenic
1065930076 10:30471577-30471599 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1066423773 10:35286053-35286075 CTTTGAGAGACTGAGGTGGACGG - Intronic
1066570911 10:36770633-36770655 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1067116739 10:43441130-43441152 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1067716281 10:48693249-48693271 GTCTGACAGTGTGGGGTGGATGG + Intronic
1068537813 10:58259587-58259609 CTTTGAGAGTCTGAGGTGGGTGG + Intronic
1068649675 10:59508277-59508299 CTGTGAAAGCATGAGGTTGGTGG + Intergenic
1068893412 10:62172390-62172412 CTGTGAAAGTTTTAGGAGGTAGG + Intergenic
1069455548 10:68551201-68551223 CTTTGGGAGTCTGAGGTGGAAGG + Intergenic
1070069282 10:73070936-73070958 CTGTGGGAGGCTGAGGTGGAAGG + Intronic
1070203082 10:74227464-74227486 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1070617914 10:77983158-77983180 TTGTGAAAGTGTCAGGTAAAGGG - Intronic
1071119312 10:82259682-82259704 CTTTGAAAGGCAGAGGTGGAAGG + Intronic
1071689811 10:87805188-87805210 GTGTGAATGTGGGAGGAGGAAGG - Intronic
1071746273 10:88422990-88423012 CTTTGAGAGGGTGAGGTGGGTGG - Intronic
1072185680 10:93036258-93036280 CTGTGAAAGACTGAAGAGGAGGG - Intronic
1072253405 10:93599831-93599853 CTGTGAAAATCAGATGTGGAGGG - Intronic
1072269700 10:93764327-93764349 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072622160 10:97087272-97087294 TTGTGACAGTGTTGGGTGGAAGG + Intronic
1073296967 10:102446434-102446456 CTTTGGGAGTTTGAGGTGGATGG + Intergenic
1073679112 10:105682911-105682933 CTGGTAAAGTGTGAGGAAGAAGG + Intergenic
1074537578 10:114339768-114339790 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1075708158 10:124515043-124515065 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1077177463 11:1197228-1197250 CTGTGGAGGTGTGAGGTGGGGGG + Intronic
1077498393 11:2897648-2897670 CTGAGAAGGTGTAAGGTGGGCGG + Intronic
1078333810 11:10448174-10448196 CAGTGGCAGTGAGAGGTGGAGGG - Intronic
1078892112 11:15566804-15566826 ATGTGAAAGTGTTTTGTGGATGG - Intergenic
1079145067 11:17843769-17843791 CTGTGAACCTCTGAGGAGGAGGG - Intronic
1079227741 11:18622284-18622306 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1079886248 11:25993125-25993147 GGGTGAGAGTGGGAGGTGGATGG - Intergenic
1080272012 11:30460374-30460396 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1080584310 11:33667635-33667657 CTTTGGAAGTCCGAGGTGGACGG - Intronic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1083094590 11:60236977-60236999 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1083285699 11:61657333-61657355 CTATGGAAGTCTGAGGTGGGCGG + Intergenic
1083468780 11:62867722-62867744 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1083533546 11:63447684-63447706 AAGTGAAGGTGTCAGGTGGATGG - Intergenic
1083754322 11:64781845-64781867 CTTTGAGAGTCTGAGGTGGGAGG + Intergenic
1084107816 11:66991666-66991688 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1084351981 11:68608617-68608639 GCATGGAAGTGTGAGGTGGAGGG + Intronic
1084536549 11:69760798-69760820 CTGTGAGTGTGTCAGGGGGAGGG + Intergenic
1085205216 11:74727646-74727668 CTTTGAAAGGCCGAGGTGGATGG - Intronic
1085635963 11:78159850-78159872 CTTTGAAAGGCTGAGGCGGATGG - Intergenic
1085655088 11:78306869-78306891 CTGTGACTATGTGAGATGGATGG - Intronic
1085842115 11:80024205-80024227 AAGTTAATGTGTGAGGTGGAGGG + Intergenic
1086317928 11:85612822-85612844 CTGTGAGAGTGTGTGGTAGTAGG - Intronic
1086417867 11:86607149-86607171 CTGTGAATGTGTTAAGTTGATGG - Intronic
1086661435 11:89423808-89423830 CTTTGAAAGGCAGAGGTGGAAGG + Intronic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1087945556 11:104156244-104156266 TTGTGGAAGGGTGAGGTGGTGGG + Intronic
1088089913 11:106025395-106025417 CTTTGCAAGGCTGAGGTGGAAGG - Intergenic
1088255159 11:107896635-107896657 CTTTGGAAGCCTGAGGTGGATGG + Intronic
1088297101 11:108311216-108311238 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1088481935 11:110302685-110302707 CTTTGAAAGGCTGAGGTGGGCGG + Intergenic
1088571946 11:111231049-111231071 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1088862656 11:113816550-113816572 ATGTGAGAGAGTGAGGAGGAGGG - Intronic
1089023413 11:115242000-115242022 CTGGGAAAGTGTGAGAGGGGTGG + Intronic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089231740 11:116983286-116983308 CTTTGGAAGGCTGAGGTGGATGG + Intronic
1089331759 11:117694157-117694179 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1089707883 11:120293706-120293728 CTGTGAAAATGTCATGGGGAGGG + Intronic
1091560025 12:1605209-1605231 GTGTGAGAGTGTGTGGGGGAGGG + Intronic
1091575319 12:1728351-1728373 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1092341349 12:7679078-7679100 CTTTGAAAGGCTGAGGCGGAAGG - Intergenic
1092710049 12:11326416-11326438 CTTTGGAAGAGTGAGGTGGGAGG - Intergenic
1092713806 12:11366910-11366932 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1092717518 12:11406087-11406109 CTTTGGAAGAGTGAGGTGGGAGG - Intronic
1093042752 12:14402839-14402861 CTTTGGAAGGGTGAGGTGGGTGG - Intronic
1093747687 12:22761806-22761828 CTTTGGAAGGGTGAGGCGGAGGG + Intergenic
1094190606 12:27694255-27694277 CTTTGAAAGGCTGAGGTGGGAGG - Exonic
1094747720 12:33365217-33365239 CTTTGAAAGGCTGAGGTGGGCGG + Intergenic
1094820782 12:34222613-34222635 CATTGAAAGGCTGAGGTGGATGG - Intergenic
1094844632 12:34356047-34356069 CTGTGAACCTGGGAGGTGCAGGG + Intergenic
1095042584 12:37459112-37459134 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1095445416 12:42277643-42277665 CTATGAAAGTGAGTGGAGGAAGG - Intronic
1095821634 12:46485150-46485172 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1096364811 12:51019886-51019908 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1096592482 12:52670157-52670179 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1096957274 12:55539489-55539511 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1097102015 12:56596544-56596566 GAGTGAAATTGTGAGGTGGATGG - Exonic
1097267356 12:57754059-57754081 CTGTGAAGGTCTTATGTGGAAGG - Intronic
1097831589 12:64230229-64230251 CTTTGGAAGGCTGAGGTGGAAGG - Intergenic
1098030322 12:66247024-66247046 CTTTGAGAGTCTGAGGTGGGTGG + Intronic
1098075126 12:66721516-66721538 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1098103893 12:67049066-67049088 CTGTGTAAGGCTGAGGTGGGAGG - Intergenic
1098253598 12:68594081-68594103 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1100245359 12:92751906-92751928 ATGTGAAAGGCTGAGGTGGGAGG + Intronic
1101209391 12:102521058-102521080 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
1101316999 12:103638394-103638416 CTGGGAAAGTGTGAGTTTAAAGG - Intronic
1101713557 12:107290544-107290566 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1101901701 12:108795610-108795632 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1101982889 12:109422828-109422850 CTTTGAAAGTCCGAGGTGGGTGG + Intronic
1102316725 12:111894273-111894295 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1102921361 12:116794020-116794042 CTTTGAGAGTGTGAGGTGGGAGG + Intronic
1103174524 12:118850990-118851012 CTCTGCAAGGCTGAGGTGGAAGG - Intergenic
1103175698 12:118861439-118861461 CAGTGAAAGTTTGAGGAGAAGGG + Intergenic
1103577542 12:121889459-121889481 CTTTGAAAGGCCGAGGTGGAAGG - Intronic
1104106735 12:125667571-125667593 CTGTAAAAGTGTTAGCTAGAAGG - Intergenic
1104784679 12:131441927-131441949 CTGCGGAGCTGTGAGGTGGATGG - Intergenic
1104973173 12:132540609-132540631 CAGTGACAGTGTGTGGTGGGCGG - Intronic
1105257751 13:18755672-18755694 CTGTGAAACTTTGAAGTTGAGGG - Intergenic
1105259932 13:18771513-18771535 CTGTGAAACTTTGAAGTTGAGGG - Intergenic
1105262612 13:18790836-18790858 CTGTGAAACTTTGAAGTTGAGGG - Intergenic
1105642919 13:22284769-22284791 CTCTGAGAGGCTGAGGTGGAAGG - Intergenic
1105913407 13:24891801-24891823 CTGGGACAGTGGGTGGTGGATGG - Intronic
1105992240 13:25633730-25633752 CTTTGAGAGTCTGAGGTGGGTGG + Intronic
1106192023 13:27462014-27462036 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1106910822 13:34461736-34461758 GTGTGTAACTGTGAAGTGGAGGG + Intergenic
1108044392 13:46369456-46369478 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1108092454 13:46863377-46863399 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1108249250 13:48548810-48548832 CTGTGAAAGTGTTGAATGGATGG - Intergenic
1108279698 13:48849298-48849320 CAGAGAAAGAGAGAGGTGGAAGG + Intergenic
1108399380 13:50023894-50023916 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1108615931 13:52132065-52132087 CAGCGTATGTGTGAGGTGGAGGG + Intergenic
1108642847 13:52398483-52398505 GTTTGAGAGTCTGAGGTGGAAGG - Intronic
1108922333 13:55691709-55691731 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1109014099 13:56986363-56986385 CTTTGATAGTGTGAAGTGGGAGG - Intergenic
1110336605 13:74339384-74339406 ACTTGAAAGTGTGAGGGGGAAGG - Intergenic
1111358315 13:87140563-87140585 CTGAGAAAGTGTGGGGTTGGGGG - Intergenic
1111463154 13:88572533-88572555 CTTTGGGAGGGTGAGGTGGAAGG + Intergenic
1112212255 13:97389457-97389479 CTTTGGGAGTCTGAGGTGGAAGG + Intronic
1112462174 13:99612766-99612788 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1112911360 13:104489092-104489114 CTGAGAAACTGTAAGCTGGAAGG + Intergenic
1113011172 13:105768066-105768088 TTGAGAAATTGTGTGGTGGATGG + Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1114328083 14:21609690-21609712 CTTTGGGAGTCTGAGGTGGAAGG + Intergenic
1114454569 14:22846560-22846582 CTGAGACAGTGTGAGGGGGTGGG + Exonic
1115047731 14:29017108-29017130 CTGTGAAAATGTGTGGTAAAAGG + Intergenic
1115466965 14:33725963-33725985 AAGAGAAAGTGGGAGGTGGAGGG - Intronic
1115710941 14:36050015-36050037 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1116265209 14:42679566-42679588 CTGTGGAAGGCTGAGGTGTAAGG - Intergenic
1116448347 14:45038148-45038170 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1116791965 14:49348729-49348751 CTGTCAGGGTGTGAGGTGCAAGG - Intergenic
1117534773 14:56693435-56693457 CTTTGGGAGTCTGAGGTGGACGG - Intronic
1118273903 14:64368413-64368435 CTTTGAAAGTCTGAGGTGGGTGG + Intergenic
1118290439 14:64516125-64516147 TTCAGAAGGTGTGAGGTGGAAGG + Intronic
1118635273 14:67743079-67743101 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1119402959 14:74376756-74376778 CTTTGAGAGGATGAGGTGGATGG + Intergenic
1119476733 14:74934819-74934841 CTTTGAAAGGGAGAGGAGGAGGG + Intergenic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119641165 14:76316013-76316035 CTCTGAGAATGTGGGGTGGAGGG - Intronic
1119667358 14:76494548-76494570 CTGTGAGAGGCTGAGGTGGGTGG - Intronic
1119707956 14:76798368-76798390 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1119996657 14:79261105-79261127 CTGGGAAGGGGTGAGGAGGAGGG + Intronic
1120207773 14:81604554-81604576 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1120933212 14:89869244-89869266 TTTTTAAAGTGTGAGGAGGAGGG - Intronic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1121803349 14:96793853-96793875 TTGGGAAAGTGTGAGGAGGTTGG - Intergenic
1123196084 14:106618056-106618078 ATTTGAAAGTCTGAGGTGGGAGG - Intergenic
1202941115 14_KI270725v1_random:146846-146868 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1123469305 15:20538408-20538430 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1123648758 15:22462290-22462312 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1123666589 15:22613333-22613355 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123720758 15:23060050-23060072 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1123729579 15:23133395-23133417 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1123747746 15:23330877-23330899 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1123751116 15:23359029-23359051 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1124280114 15:28354728-28354750 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1124283491 15:28382947-28382969 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124299207 15:28528666-28528688 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124302586 15:28556883-28556905 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1124320432 15:28707906-28707928 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1124482082 15:30087504-30087526 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124488540 15:30139604-30139626 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124521508 15:30409699-30409721 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124537153 15:30556520-30556542 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124543627 15:30608576-30608598 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124754988 15:32398718-32398740 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124761496 15:32451071-32451093 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124777135 15:32597997-32598019 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124814265 15:32973034-32973056 CAGTGAAAGATTGAGGTGGTGGG - Intronic
1124912195 15:33932581-33932603 CTTTGGAAGGCTGAGGTGGAGGG + Intronic
1124921481 15:34030859-34030881 CTTTGGGAGGGTGAGGTGGAAGG - Intronic
1124959701 15:34385207-34385229 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124976327 15:34531428-34531450 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1125016202 15:34938288-34938310 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1125641654 15:41236185-41236207 CTTTGAAAGTCTGGGGTGGAAGG - Intronic
1125740482 15:41959722-41959744 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1125815259 15:42578453-42578475 ATGGGAAACTGTGAGGTAGAGGG - Intronic
1125866831 15:43059306-43059328 CTGTGAGAGGCTGAGGTGGAAGG - Intronic
1125884403 15:43217966-43217988 ATGTGAAAGTGTGCAGAGGAGGG + Intronic
1126461637 15:48920838-48920860 CTTTGGAAGTCTGAGGTGGGAGG + Intronic
1126479676 15:49104173-49104195 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1127420263 15:58798366-58798388 CTTTGAGAGTGTAAGGTGGGTGG - Intronic
1127479481 15:59365260-59365282 CTTTGGAAGGCTGAGGTGGAGGG - Intronic
1127682226 15:61309054-61309076 GTGTGAGTGTGTGGGGTGGAGGG + Intergenic
1127683191 15:61317051-61317073 CTGTGAGAGTGAGAGGCCGAAGG - Intergenic
1127765218 15:62179315-62179337 GTGTGATAGAGTGAGGAGGAAGG - Intergenic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1128434804 15:67636167-67636189 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1129029641 15:72609017-72609039 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1129035352 15:72645694-72645716 CTTTGAAAGCCTGAGGTGGGCGG - Intergenic
1129037580 15:72660051-72660073 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129212307 15:74077174-74077196 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1129214532 15:74091522-74091544 CTTTGAAAGCCTGAGGTGGGCGG + Intergenic
1129327766 15:74810481-74810503 CTTTGAGAGGCTGAGGTGGACGG + Intergenic
1129398090 15:75263905-75263927 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129401701 15:75288186-75288208 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129475293 15:75780893-75780915 CTGTCAAAGTGACAGGTTGAAGG - Intergenic
1129729436 15:77921492-77921514 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1129731664 15:77935868-77935890 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1129839081 15:78732478-78732500 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1131109730 15:89757819-89757841 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1131115295 15:89791694-89791716 CTTTGGAAGACTGAGGTGGATGG - Intronic
1133049604 16:3109747-3109769 CTGGGACAGTGTGGGGTGAAAGG + Intergenic
1133071744 16:3251086-3251108 CTGGGACACTGTGAGGTGGGAGG - Intronic
1135090070 16:19506888-19506910 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1135280717 16:21151989-21152011 CTCTGAAAGGCTGAGGTGGATGG + Intronic
1135566582 16:23515945-23515967 CTGTGGGAGGCTGAGGTGGAAGG - Intronic
1135646308 16:24165284-24165306 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1135971808 16:27077636-27077658 CTTTGGGAGTCTGAGGTGGATGG - Intergenic
1136179509 16:28541319-28541341 TTTTGAAAGGCTGAGGTGGAAGG + Intergenic
1136357390 16:29754248-29754270 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1136416833 16:30109286-30109308 CTTTGAAAGTCTGAGGTGGGAGG + Intronic
1136551056 16:30982827-30982849 CAGTGAGAGGGTGAGGGGGACGG + Intronic
1136575125 16:31118990-31119012 CTCTGAGAGGGTGAGGTGGGAGG - Intronic
1136614808 16:31391998-31392020 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1137242687 16:46670526-46670548 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1137630172 16:49937731-49937753 CTTTGAAAGGCTGAGGTGGTGGG - Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138579954 16:57934209-57934231 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1138665140 16:58560633-58560655 CTTTGAAAGGCTGAGGCGGAAGG + Intronic
1139687885 16:68618468-68618490 CTTTGGAAGTCTGAGGTGGGAGG - Intergenic
1140134661 16:72195315-72195337 CTGTGAAAAGGAGAGGGGGAAGG - Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140711365 16:77680978-77681000 CTTTGAAAGGCTGAGGTGGAAGG - Intergenic
1141085442 16:81091860-81091882 CTGTGAGAGGTTGAGGTGGGAGG - Intronic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141358277 16:83370142-83370164 CTTTGGAAGTCTGAGGCGGACGG + Intronic
1141449826 16:84091240-84091262 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1141957184 16:87380509-87380531 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1142111241 16:88332826-88332848 CTGTGAAACGGTGAGGAGGCTGG - Intergenic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1142803316 17:2358464-2358486 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1143742988 17:8967259-8967281 CTGTGAAAGGGTGACGTGTGGGG - Intergenic
1143871978 17:9963622-9963644 CTTTGAGAGGTTGAGGTGGAAGG + Intronic
1144812448 17:18009168-18009190 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145123425 17:20280983-20281005 CTGCGTTAGTGTGAGGAGGAAGG + Intronic
1146051080 17:29554018-29554040 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
1146369899 17:32259179-32259201 CTTTGGAAGTCTGAGGTGGGTGG + Intergenic
1146394235 17:32450202-32450224 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1147199719 17:38792385-38792407 CTTTGAGAGACTGAGGTGGATGG - Intronic
1147670076 17:42171760-42171782 CTGTGAAAGTTTGGGGTCGGTGG + Intronic
1147683081 17:42266629-42266651 CTGTGGAAGGTTGAGGTGGGAGG + Intronic
1147688892 17:42303464-42303486 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1147861201 17:43524642-43524664 TTGCGAATGTGGGAGGTGGAGGG - Exonic
1148333831 17:46828444-46828466 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1149547042 17:57511388-57511410 CTGGGTAAGTGTGGGGTGGGTGG - Intronic
1149582928 17:57763756-57763778 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1149830615 17:59868450-59868472 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151442553 17:74140866-74140888 CTTTGAGAGTCTGAGGTGGATGG + Intergenic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1151907872 17:77060891-77060913 CAGTGAAAGTGTAATGGGGAAGG - Intergenic
1152618429 17:81348559-81348581 CTGGGACAGTGGGAGGGGGATGG + Intergenic
1152661617 17:81544923-81544945 CTTTGAGAGGGTGAGGTGGGCGG + Intronic
1152972728 18:179842-179864 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1152980700 18:273496-273518 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1153013745 18:564943-564965 TTGTGTACGTGTGAGGAGGAGGG + Intergenic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153170577 18:2311519-2311541 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1153208949 18:2737475-2737497 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1153518926 18:5933710-5933732 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1153709899 18:7787622-7787644 GTGTGAATGTGTGAGGGGCAAGG - Intronic
1154080067 18:11247665-11247687 GTGTGAAAGTGTGTGGTGTGAGG - Intergenic
1154102497 18:11489206-11489228 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1154965710 18:21354030-21354052 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1154978944 18:21486402-21486424 ATGTCAAAGTCTGAGGTGTAGGG - Intronic
1155159593 18:23184945-23184967 CTGTGATAGTATGAGGTGGTGGG - Intronic
1155536803 18:26827181-26827203 CTGTGAAAATGAGAGGGGGTGGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155976141 18:32133793-32133815 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
1156376895 18:36522868-36522890 ATGTTCAAGTGTGATGTGGAGGG + Intronic
1157377457 18:47179428-47179450 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1157682360 18:49616992-49617014 CTCTGTAAGTGTGAGTTGCAGGG + Intergenic
1157725906 18:49963669-49963691 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1158169051 18:54575680-54575702 CTTTGGAAGTCTGAGGTGGGAGG - Intergenic
1158698736 18:59727238-59727260 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159344831 18:67188222-67188244 CTTTGAGAGGGTGAGGTGGGTGG + Intergenic
1159698624 18:71593675-71593697 CTGTGAAACTGTAAGGTGAATGG + Intergenic
1161149671 19:2701429-2701451 TTGTGAGTGTGTGGGGTGGAAGG - Intronic
1161425549 19:4200764-4200786 CTTTGGGAGTCTGAGGTGGAAGG - Intronic
1161721655 19:5905936-5905958 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
1163160412 19:15461027-15461049 CAGTGAAGGTGGGAGGTAGAGGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163306342 19:16481846-16481868 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1163421093 19:17214066-17214088 CTTTGGGAGGGTGAGGTGGATGG - Intronic
1163425830 19:17240560-17240582 CTGTGAAAGGGAGGGGTGAAAGG + Intronic
1163913683 19:20219169-20219191 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1164015279 19:21251039-21251061 CTTTGGGAGTCTGAGGTGGATGG + Intronic
1164409411 19:27987708-27987730 ATGTGAGAATGTGAGGTGGCAGG + Intergenic
1164982257 19:32623033-32623055 CTGTGAGAGGCTGAGGTGGGAGG - Intronic
1165396343 19:35565806-35565828 CTCTGGAAGGCTGAGGTGGACGG + Intergenic
1165959086 19:39519555-39519577 CTTTGAAAGCCTGAGGTGGGTGG + Intronic
1166214028 19:41324130-41324152 CAGGGAAAGTGAGAGCTGGATGG + Exonic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166502201 19:43350074-43350096 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1166507907 19:43383375-43383397 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1166744735 19:45136024-45136046 CTTTGGAAGGCTGAGGTGGACGG - Intronic
1167082847 19:47289065-47289087 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1167173151 19:47847153-47847175 CTTTGGAAGACTGAGGTGGAAGG + Intergenic
1167377439 19:49119513-49119535 CAGTGAGAGCGTGAGGGGGAGGG + Exonic
1167407578 19:49323919-49323941 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1167954382 19:53052460-53052482 CTTTGGAAGTCTGAGGTGGGTGG + Intergenic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925238711 2:2302451-2302473 CTTTGAAATGGTGAGGAGGAGGG + Intronic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927773688 2:25885491-25885513 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
927825510 2:26306840-26306862 CTTTGAGAGTCTGAGGTGGAAGG - Intergenic
927889927 2:26741876-26741898 TTGTGAAAGTGTGGGGAGGAGGG + Intergenic
928159560 2:28909627-28909649 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
928507770 2:31971617-31971639 CTTTGCAAGGCTGAGGTGGAAGG - Intronic
928574446 2:32640737-32640759 CTTTGAGAGGCTGAGGTGGACGG + Intronic
928880092 2:36088228-36088250 CTTTGAAAGCCTGAGGTGGGCGG - Intergenic
929046073 2:37791883-37791905 CTGAAAAAGTGTGTGGTGGTTGG + Intergenic
929860482 2:45672780-45672802 CTGTGAGAGGCTGAGGTGGGAGG + Intronic
930782618 2:55237892-55237914 CTTTGAGAGTCTGAGGTGGGTGG - Intronic
930868961 2:56150592-56150614 TTGTTAAAGTGTGGGGAGGAGGG - Intergenic
931003593 2:57820636-57820658 CTGTGAGAGGCTGAGGTGGGAGG + Intergenic
932566385 2:72913801-72913823 CTATGAAAGAATGGGGTGGAGGG + Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932643356 2:73474581-73474603 CTTTGAGAGACTGAGGTGGAAGG - Intronic
932727019 2:74188332-74188354 CAGTGGAAGTGTGAGGAGGGTGG - Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
933826680 2:86167723-86167745 CTTTGAGAGGCTGAGGTGGATGG - Intronic
935228974 2:101079617-101079639 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
935626317 2:105174994-105175016 CTGTGAAAGTGAGAGATCTATGG - Intergenic
936269474 2:111037811-111037833 CTCTTAAAGAGTGCGGTGGATGG - Intronic
936948543 2:117953783-117953805 ATGTGGAAGGCTGAGGTGGAAGG + Intronic
937117294 2:119417127-119417149 CTTTGAGAGTCTGAGGTGGGAGG - Intergenic
937502093 2:122490318-122490340 CATTGAAAGTGTGAGGCAGATGG - Intergenic
937629506 2:124084510-124084532 CTTTGAGAGGCTGAGGTGGATGG - Intronic
938269019 2:129952489-129952511 CTGTGGGAGGGTGAGGTGGGTGG - Intergenic
938385797 2:130866125-130866147 CTTTGGGAGTCTGAGGTGGAAGG + Intronic
938582056 2:132655297-132655319 CTGAGAAAGTCTAAGTTGGAGGG - Intronic
939344499 2:140946354-140946376 CTTTGAGAGGCTGAGGTGGATGG + Intronic
939495942 2:142928762-142928784 CTTTGACAGTCTGAGGTGGGTGG + Intronic
939530542 2:143354918-143354940 CTTTGAAATTGTGAAATGGAAGG - Intronic
939849891 2:147292005-147292027 CTGAGAAAGTGTGGGGTGTGGGG - Intergenic
939859783 2:147405253-147405275 TTGTATAAGTGTGAGGTGTAAGG - Intergenic
940237816 2:151529771-151529793 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
940313721 2:152305792-152305814 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
940434969 2:153640533-153640555 CTTTGGAAGGGTGAGGTGGGAGG + Intergenic
941077450 2:161022030-161022052 CTTTGAAAGACTGAGGTGGGAGG - Intergenic
941297500 2:163758472-163758494 CTTTGAAAGTCTGAGTTGGGGGG + Intergenic
941778913 2:169423397-169423419 ATGTGAAATTGTTGGGTGGAAGG - Intergenic
942579102 2:177397178-177397200 CTTTGAGAGTCTGAGGTGGGTGG - Intronic
942648566 2:178142794-178142816 CCTTGAAAGAATGAGGTGGAAGG + Intergenic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
943270454 2:185795523-185795545 CTGTGAAAGTCTGAGATGTGAGG - Exonic
943937060 2:193933266-193933288 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
944155778 2:196606108-196606130 GTGTGATAGTGTTAGGTGGTGGG + Intergenic
944536748 2:200717726-200717748 CTGTGGGAGGCTGAGGTGGAAGG + Intergenic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944735367 2:202558073-202558095 CTGTGGAAGACTGAGGTGGGTGG + Intronic
944823753 2:203459003-203459025 CTTTGGGAGTCTGAGGTGGATGG - Intronic
944925218 2:204457208-204457230 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
945277053 2:207998401-207998423 ATTTGGAAGGGTGAGGTGGAAGG + Intronic
945844594 2:214929232-214929254 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
946264772 2:218529728-218529750 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946540786 2:220682272-220682294 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
947154166 2:227144819-227144841 CTCTGAAAGTGAGACCTGGAGGG + Intronic
947179684 2:227401053-227401075 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
947449899 2:230198200-230198222 CTGTGGAAGTGTGTGGAAGAGGG - Intronic
948449306 2:238059218-238059240 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948861038 2:240752696-240752718 CTGGGAAAATGTGGGGTGGGTGG - Intronic
948926706 2:241103379-241103401 CTGTGAGAGGCTGAGGTGGGGGG + Intergenic
1169159161 20:3361477-3361499 CAGGGAAAGTGGGAGGTGGGAGG + Intronic
1169485166 20:6024197-6024219 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1170097267 20:12660049-12660071 ATGTGAAAGTATGAGGTACATGG - Intergenic
1171017317 20:21553501-21553523 CTTTGAGAGACTGAGGTGGAAGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171537015 20:25902186-25902208 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1171804093 20:29658968-29658990 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1172077157 20:32307989-32308011 CTTTGAGAGAATGAGGTGGAGGG + Intronic
1172093353 20:32448590-32448612 CTGTGCCTGAGTGAGGTGGAGGG + Intronic
1172628830 20:36364849-36364871 CTTTGAGAGGCTGAGGTGGATGG + Intronic
1173341625 20:42157587-42157609 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1173586523 20:44187052-44187074 CAGTGAAAGGGTGGGGTGGAGGG + Exonic
1174324731 20:49770161-49770183 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
1175002388 20:55643241-55643263 GTGTGAATGTGTGAGTTGGGGGG - Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1176582046 21:8540096-8540118 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1177046543 21:16177513-16177535 ATGTGAAATTGTGAGAGGGAAGG + Intergenic
1177278913 21:18952409-18952431 CTCCGAAAGTGGGAGCTGGATGG + Intergenic
1177348175 21:19900317-19900339 CTGTGCATGTGTAGGGTGGAGGG - Intergenic
1178109492 21:29356079-29356101 CTGTGAGAGTGTGTGGTAGTAGG + Intronic
1178270880 21:31188815-31188837 CTGTGAGAGGCTGAGGTGGGAGG - Intronic
1178565067 21:33676469-33676491 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1180264883 22:10517144-10517166 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1180745876 22:18088533-18088555 CTTTGGAAGGGTGAGGTGGGTGG + Exonic
1181733432 22:24863982-24864004 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1182268648 22:29138760-29138782 CTGGGACAGTCTGAGGTGGGTGG - Exonic
1182407807 22:30152572-30152594 CTTTGAGAGGGTGAGGTGGGAGG - Intronic
1182556222 22:31129962-31129984 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1183470305 22:38002091-38002113 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1183623066 22:38986084-38986106 CTATGAAGGTGAGAGGTGGAGGG + Exonic
1183629622 22:39025342-39025364 CTATGAAGGTGAGAGGTGCAGGG + Exonic
1183633077 22:39045213-39045235 CGATGAAGGTGAGAGGTGGAGGG + Exonic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1183918163 22:41140561-41140583 GTTTGAAAGTCTGAGGTGGGCGG + Intronic
1184013210 22:41765257-41765279 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1184297328 22:43533240-43533262 CTCTGAGTGTGTGTGGTGGATGG - Intronic
1184972274 22:48033209-48033231 CTTTGGAAGGGTGAGGTGGATGG - Intergenic
1185195433 22:49466511-49466533 CTGCGGCAGTGAGAGGTGGAAGG + Intronic
949199580 3:1358825-1358847 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
949437627 3:4046605-4046627 CTGGGAAAGAGTGAGGTAAAGGG - Intronic
951639635 3:24822293-24822315 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
951896246 3:27612432-27612454 CTTTGAGAGGTTGAGGTGGAAGG + Intergenic
951919469 3:27838603-27838625 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
952132544 3:30382665-30382687 CTTTGAGAGGTTGAGGTGGATGG - Intergenic
952281567 3:31928451-31928473 TTGTGCAAGTCTGAGGTAGATGG - Intronic
952463401 3:33553981-33554003 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
952542125 3:34377694-34377716 CTGTGACAGAGTGTGGAGGAGGG + Intergenic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
953270964 3:41444734-41444756 CTTTGAAAGGCCGAGGTGGACGG + Intronic
953293170 3:41686972-41686994 CTTTGGGAGTGTGAGGTGGGAGG + Intronic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953988773 3:47467359-47467381 CTTTGGAAGGCTGAGGTGGATGG + Intronic
954056489 3:48030143-48030165 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
954084157 3:48230910-48230932 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
954618481 3:51982759-51982781 ATGTGACAGTGTGAGATGGTGGG - Intronic
955099168 3:55830698-55830720 CTTTGGAAGTCTGAGGTGGGAGG + Intronic
955221417 3:57026424-57026446 CTGTGCAAGCGTGGGGTGGGAGG - Intronic
955474561 3:59322600-59322622 CTGTGAAAGTGATGGATGGAGGG + Intergenic
955683384 3:61525948-61525970 CTTTGGAAGGGTGAGGTGGGAGG - Intergenic
956371495 3:68567805-68567827 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
957050907 3:75411146-75411168 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
958510304 3:95038531-95038553 CTCCCAAAGTGTGAGGGGGAGGG - Intergenic
959117538 3:102195782-102195804 CTGTGAAGGTTTGAGGTGAGTGG - Intronic
959526813 3:107386785-107386807 CTGAGAAAAACTGAGGTGGAAGG - Intergenic
959551845 3:107668975-107668997 CTCTGAATGTGGGAGGGGGATGG - Intronic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
961883197 3:130077581-130077603 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
962307819 3:134304324-134304346 CTTTGGAAGTCTGAGGTGGAAGG + Intergenic
962387941 3:134948035-134948057 CTTTGGAAGGGTGAGGTGGGAGG - Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
963138026 3:141925221-141925243 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
963209201 3:142670078-142670100 CTGTGAGAGTTTGTGGTAGAAGG + Intronic
963927008 3:150961251-150961273 CTGAGAATGACTGAGGTGGATGG - Intronic
963984846 3:151580097-151580119 CTGTGAGAGGCTGAGGTGGGAGG + Intergenic
964600082 3:158490325-158490347 CTTTGGAAGGGTGAGGTGGGTGG - Intronic
964607212 3:158571903-158571925 GTTTGAAAGCGTGAGGTGGGGGG + Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965335234 3:167425589-167425611 CTTTTAAAGTGTGCTGTGGATGG - Intergenic
966031716 3:175356926-175356948 ATGTGAAAGTGTGAGGTCTCGGG + Intronic
966919977 3:184604745-184604767 CTGAGAAAGTGTGGAGTGGAAGG + Intronic
966974156 3:185070276-185070298 CTGAGACATTGTGACGTGGAGGG + Intergenic
967087263 3:186107413-186107435 TTGTGAATGTGTTAGGAGGAAGG + Intronic
967247725 3:187504818-187504840 CTTTGAGAGGGTGAGGTGGGAGG - Intergenic
967882557 3:194312297-194312319 CTTTGGGAGTCTGAGGTGGAAGG - Intergenic
968460718 4:723514-723536 CTGTGAAAGTGAGAGCTGTGTGG + Intronic
968527289 4:1067619-1067641 CTTTGGAAGGCTGAGGTGGATGG + Intronic
968585004 4:1412243-1412265 CTGTGAAAGCTTGGGTTGGAGGG - Intergenic
968859538 4:3155466-3155488 CTTTGAGAGGCTGAGGTGGACGG - Intronic
969093370 4:4713619-4713641 CTTTGAAAGTCTGAGATGGGAGG + Intergenic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969540496 4:7785691-7785713 CTTTGAAAGTCTGAGGTGGGAGG + Intronic
970162842 4:13206702-13206724 ATGAGAAATTGAGAGGTGGACGG - Intergenic
971364503 4:25966951-25966973 CTTTGAGAGGGTGAGGTGGGCGG - Intergenic
971717457 4:30197682-30197704 CTTTGAGAGACTGAGGTGGAAGG + Intergenic
973280687 4:48357940-48357962 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
974360735 4:60876008-60876030 CTTTGAGAGGGTGAGGTGGGTGG - Intergenic
975235426 4:71989919-71989941 CTGTGCAGCTGTGAGTTGGATGG + Intergenic
975858923 4:78655406-78655428 CTCTGGAAGGCTGAGGTGGATGG + Intergenic
976189016 4:82471434-82471456 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
976218499 4:82736907-82736929 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
976558200 4:86473904-86473926 CTTTGGAAGTCTGAGATGGAAGG + Intronic
976747767 4:88421687-88421709 CTTTGAAAGACTGAGGTGGGTGG - Intronic
977336478 4:95706144-95706166 CTGTGGAAGGCTGAGGTGGGAGG + Intergenic
977998272 4:103522973-103522995 CTGTGGATGTGTGATGTTGATGG - Intergenic
978499781 4:109396826-109396848 CTTTGAAAGGCTGAAGTGGATGG + Intergenic
978798820 4:112735139-112735161 CTGTGAGAGGCTGAGGTGGGTGG + Intergenic
979490020 4:121315286-121315308 CTGTTAAAATGAGTGGTGGATGG - Intergenic
981426459 4:144609055-144609077 CTGTCCAAATGTGAAGTGGATGG + Intergenic
981458951 4:144990012-144990034 CTATAAAAGTGTGAGGTGAAGGG + Intronic
981794384 4:148579676-148579698 CTGTGAGAGGCTGAGGTGGGTGG + Intergenic
982175137 4:152699101-152699123 GTGTGGAAGTTTGAGGTGGATGG - Intronic
982294315 4:153811102-153811124 CTTTGAGAGACTGAGGTGGAAGG + Intergenic
982357192 4:154483863-154483885 CTGTGAAAGTGTCAGGATAATGG - Intronic
982388113 4:154835199-154835221 CTTTGAGAGTCTGAGGTGGGAGG + Intergenic
982711623 4:158763680-158763702 CTGTAAGATTGTCAGGTGGATGG + Intergenic
983301924 4:165936682-165936704 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
983919321 4:173328847-173328869 CTTTGGGAGTGTGAGGTGGGAGG - Intergenic
983934514 4:173491884-173491906 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
985520230 5:370714-370736 AGGTGACAGTGTGGGGTGGAGGG + Intronic
986157786 5:5193855-5193877 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
986251050 5:6058921-6058943 TTGTGAAGGTGTGAGGGGGGTGG + Intergenic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
987237339 5:15956177-15956199 CTGTGAAAGTGTAAGGACTAAGG + Intergenic
987472533 5:18350907-18350929 CTGTGAAAGTGTCTGGGAGAGGG + Intergenic
988364135 5:30273701-30273723 TTGAGAAAGTGTGATGTGAAAGG + Intergenic
988562848 5:32296554-32296576 CTTTGGAAGGGTGAGGTGGTGGG + Intronic
988790385 5:34602319-34602341 GTGAGAAAGTATGTGGTGGAGGG - Intergenic
988796893 5:34659509-34659531 CTGTGGAAGGCTGAGGTAGAAGG - Intronic
988967316 5:36432338-36432360 TTGGGATAGTGGGAGGTGGATGG + Intergenic
988971334 5:36471276-36471298 CTGTCAAGGGGTGGGGTGGAAGG + Intergenic
989594069 5:43139970-43139992 CTTTGGAAGGCTGAGGTGGATGG + Intronic
990235228 5:53760049-53760071 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
990823743 5:59873965-59873987 CTGTGAGAGACTGAGGTGGGAGG + Intronic
991449166 5:66733313-66733335 CTGTGCATGTGTGTGGTGGGGGG - Intronic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993251915 5:85538173-85538195 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
993473600 5:88336202-88336224 CTTTGGAAGAATGAGGTGGAAGG - Intergenic
993505581 5:88705063-88705085 CTTTGAGAGGTTGAGGTGGAAGG + Intergenic
994028914 5:95118014-95118036 CTGTCAAGGGGTGAGGTGGAGGG + Intronic
994698143 5:103098700-103098722 CTTTGAAAGACTGAGGTGCATGG - Intronic
994901231 5:105772266-105772288 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
994924764 5:106100605-106100627 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
995220705 5:109644565-109644587 CTCTGAAATTGTGAGGTGAGCGG - Intergenic
995654413 5:114409009-114409031 CTGTGACAGTGTGGTGGGGAAGG + Intronic
996227562 5:121019334-121019356 CTCTGAAAGAATGAGGTGGTGGG - Intergenic
996476285 5:123925936-123925958 CTGTGAATGTGTGGGGTGCCTGG + Intergenic
997295893 5:132768171-132768193 CTGTGGAAGTGTGGGGTACAGGG + Intronic
997431932 5:133846898-133846920 CTCTGACAGTGTGAGATGGGTGG - Intergenic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
998016838 5:138739010-138739032 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
998334405 5:141357944-141357966 CTTTGGGAGTGTGAGGAGGACGG + Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998828464 5:146131732-146131754 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
999450999 5:151678089-151678111 CTGAGATAGTTTGAGGTTGAAGG + Intronic
999903388 5:156112021-156112043 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1000848042 5:166305623-166305645 CTGAGAAAGGGTGGGGAGGATGG - Intergenic
1001071321 5:168587601-168587623 CTGGGCAAGTGGGTGGTGGATGG - Intergenic
1001425960 5:171622835-171622857 GTGTGAAAGAGTGAGGTCGAGGG - Intergenic
1001976477 5:176003996-176004018 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1001980385 5:176034065-176034087 CTGGGAAGGTGTGTGTTGGAGGG - Intronic
1002237076 5:177810000-177810022 CTGGGAAGGTGTGTGTTGGAGGG + Intergenic
1002687068 5:181021072-181021094 CTGTAAAAATGTGTGGTGGCAGG - Intergenic
1002970415 6:2011668-2011690 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1002978214 6:2107702-2107724 CTGTGAATAGGTGATGTGGATGG - Intronic
1003067992 6:2919600-2919622 CTGGCAAAGTGAGATGTGGAGGG + Intergenic
1003268010 6:4583568-4583590 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1003817523 6:9858811-9858833 AAGAGAAAGTTTGAGGTGGAAGG + Intronic
1004124213 6:12856497-12856519 CTTTGGAAGGCTGAGGTGGACGG - Intronic
1004662560 6:17723024-17723046 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1004691402 6:17995390-17995412 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1004721803 6:18274250-18274272 CTTTGAGAGGGTGAGGTGGGAGG - Intergenic
1004987590 6:21100126-21100148 CTGTGAAAATGAGAGGCTGATGG + Intronic
1005089396 6:22041130-22041152 CTTTGGAAGGCTGAGGTGGATGG + Intergenic
1005373032 6:25154751-25154773 CTGGGAAAGTGTGAAGGGTAGGG - Intergenic
1005602660 6:27443550-27443572 GTGTGGATGTCTGAGGTGGAAGG - Intergenic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005956424 6:30666562-30666584 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1006648655 6:35533272-35533294 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1007517249 6:42422604-42422626 ATGTGAGACTCTGAGGTGGAAGG - Intronic
1007588736 6:43008670-43008692 CTGCAAAGGTGTGAGGTAGAAGG - Intronic
1008012986 6:46488939-46488961 CTGTGGAGGTGTGAGGAGGTGGG - Intronic
1008063801 6:47026419-47026441 CTTTGTAAGTGTGAGATTGAGGG - Intronic
1008440642 6:51528360-51528382 CTGTGAAAATTTGAGGTGCAGGG + Intergenic
1008598824 6:53068891-53068913 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1008816990 6:55579910-55579932 ATGTGAAAGTGAGGGGGGGAAGG - Intergenic
1008895219 6:56545298-56545320 TTGTGAAAATGTGAGGGGGCTGG - Intronic
1010240683 6:73612806-73612828 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1010688764 6:78883011-78883033 CTTTGAGAGTCTAAGGTGGAAGG + Intronic
1011317061 6:86046382-86046404 CTTTGAAAGGCTGAGGTGGTAGG - Intergenic
1011425148 6:87220068-87220090 CTATGAAAGGCTGAGGTGGGAGG - Intronic
1011904341 6:92343458-92343480 CTTTGAAAGGCTGAGGTGGAAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013386910 6:109640658-109640680 CTTTGGAAGGCTGAGGTGGAAGG - Intronic
1013816522 6:114104869-114104891 CTGTCAAAGTTTTAAGTGGATGG - Intronic
1013827573 6:114232432-114232454 CTGTGAGAGGCTGAGGTGGGTGG - Intronic
1014546183 6:122739226-122739248 CTTTGAAAGGCAGAGGTGGATGG + Intergenic
1014806010 6:125830443-125830465 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1014955195 6:127606617-127606639 CAGTGAAAAAGTGAGCTGGATGG - Intergenic
1015398143 6:132758284-132758306 CTTTGAGAGGCTGAGGTGGATGG - Intronic
1017009639 6:150054583-150054605 CTGTTGTAGTGTGAGGTGCATGG - Intergenic
1017031042 6:150222358-150222380 GTGTACATGTGTGAGGTGGATGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017488097 6:154921295-154921317 CTGGGTATGTGTGAGGGGGAGGG - Intronic
1017985866 6:159442740-159442762 CTTTGACAGTGTCAGGTGGTAGG + Intergenic
1018068521 6:160140838-160140860 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1018261996 6:161979515-161979537 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1018275668 6:162128258-162128280 AAATGAAAGTGTGAAGTGGATGG + Intronic
1018393300 6:163357544-163357566 CTTTGGAAGTCTGAGGTGGGTGG + Intergenic
1018932542 6:168250769-168250791 CCGTGAGATTTTGAGGTGGATGG - Intergenic
1019012739 6:168855122-168855144 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1019181274 6:170188603-170188625 CTGGGAAAGTGTGACCTGGCTGG - Intergenic
1019261298 7:83520-83542 CTTTCAAAGTGTGAGGGGCAGGG + Intergenic
1019933199 7:4237133-4237155 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1019992153 7:4699609-4699631 CTGTGGAAGCCTGAGGTGGGTGG - Intronic
1020031339 7:4934940-4934962 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020317219 7:6914313-6914335 TTTTGAAAGGCTGAGGTGGATGG + Intergenic
1020499301 7:8895820-8895842 CTGAGAAAGTGTATGTTGGAAGG - Intergenic
1020849733 7:13336844-13336866 CTGTGGAAGGCTGAGGTGGGCGG - Intergenic
1022616917 7:31940946-31940968 GTGTGGAGGTGTGAGTTGGAAGG - Intronic
1023440037 7:40175986-40176008 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1023659789 7:42459965-42459987 CTTTGAAAGGGTGAGGCAGAAGG - Intergenic
1023962569 7:44939341-44939363 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1024391509 7:48818290-48818312 CTTTGAAAGGTTGAGGTGGGTGG + Intergenic
1024527219 7:50359014-50359036 CTTTGAGAGACTGAGGTGGAAGG + Intronic
1025068905 7:55881948-55881970 CTTTGAGAGGCTGAGGTGGAAGG + Intergenic
1025288475 7:57688889-57688911 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1025850107 7:65238042-65238064 ATGTGAAAGTGGGTGGGGGAGGG + Intergenic
1025898150 7:65722976-65722998 CTTTGAAAGGCTGAGGAGGATGG - Intergenic
1025980727 7:66403186-66403208 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1026051316 7:66949055-66949077 CTGTGGAAGGCTGAGGTGGGAGG + Intronic
1026328988 7:69335833-69335855 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1026396479 7:69959601-69959623 CAGTGACAGTATGATGTGGAAGG - Intronic
1026614178 7:71887080-71887102 GTGTGAAGGTGTAAGGAGGATGG + Intronic
1026641356 7:72128625-72128647 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1026829511 7:73602425-73602447 CTTTGAGAGGCTGAGGTGGACGG + Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027710767 7:81598831-81598853 CTTTGAAAGGCTGAGGTGGAAGG + Intergenic
1027890525 7:83967509-83967531 CTTTGGAAGGCTGAGGTGGACGG + Intronic
1027950132 7:84804667-84804689 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1028020847 7:85769043-85769065 ATGTGAAAGTGTGAAGTGGGAGG - Intergenic
1028399158 7:90405854-90405876 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1029089087 7:98034097-98034119 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1029378141 7:100194541-100194563 CTTTGGGAGAGTGAGGTGGAAGG + Intronic
1029680516 7:102105754-102105776 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1030028413 7:105347430-105347452 CTTTGAGAGGGTGAGGTGGGAGG - Intronic
1030105968 7:105987648-105987670 CTGTGAAAGTCTGATGTGATTGG + Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031146069 7:117998341-117998363 CTGTGAAAGTGTGTGGTCTAAGG + Intergenic
1031279451 7:119778864-119778886 ATTTGAAAGGCTGAGGTGGAAGG - Intergenic
1031941762 7:127797134-127797156 CTGTGGGAGGGTGAGGTGGGTGG - Intronic
1032204170 7:129847281-129847303 CTTTGGGAGTCTGAGGTGGATGG - Intronic
1032257642 7:130310008-130310030 CTTTGAGAGGCTGAGGTGGAAGG - Intronic
1032365331 7:131293563-131293585 CTTTGGAAGACTGAGGTGGAAGG + Intronic
1032601913 7:133306452-133306474 CTATGAGAGGCTGAGGTGGAAGG + Intronic
1032978448 7:137252921-137252943 CTGTGAAACTGTGTGGAGGTTGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033129268 7:138731647-138731669 CTTTGGGAGTCTGAGGTGGATGG + Intronic
1033156970 7:138965432-138965454 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
1033160945 7:138996122-138996144 CTCTGAAAGTGTGTGTAGGAGGG + Intergenic
1033183349 7:139202119-139202141 CTTTGAAAGACTGAGGTGGGAGG + Intergenic
1033400655 7:141021015-141021037 CTTTGAAAGGCTGAGGCGGAAGG + Intergenic
1034141499 7:148822696-148822718 CTGTGAGAGGCTGAGGTGGGTGG + Intronic
1034612369 7:152382881-152382903 CTCTCAAAGATTGAGGTGGAGGG + Intronic
1034681005 7:152927346-152927368 CTGTGGAAGGCTGAGGTGGGTGG + Intergenic
1034748026 7:153541315-153541337 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1035174836 7:157043018-157043040 CTGTGAAAATGTGAGGCATATGG + Intergenic
1035334261 7:158115507-158115529 AGGTGAAGGTGTGAGGAGGAGGG + Intronic
1035392740 7:158516234-158516256 CTTTGGAAGGCTGAGGTGGAAGG + Intronic
1036555867 8:9859987-9860009 CTTTGACAGGCTGAGGTGGAAGG - Intergenic
1036997953 8:13681138-13681160 CTGTGGAAGGCTGAGGTGGGTGG - Intergenic
1037362780 8:18091607-18091629 CTTTGAACCTGGGAGGTGGAGGG - Intergenic
1037499302 8:19470111-19470133 GTGAGAAGGTGAGAGGTGGATGG + Intronic
1037774139 8:21821737-21821759 TTGTGAAAGTGTGAAGTGGACGG - Intergenic
1037813898 8:22102071-22102093 CTGTGAACGTGTGTGGGGGTGGG - Intronic
1038182650 8:25243570-25243592 CTTTGAGAGGGTGAGGTGGGTGG - Intronic
1038456463 8:27674968-27674990 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1038481048 8:27902061-27902083 CAGTGAAATTGGGAGGTGAAGGG - Intronic
1038666836 8:29544919-29544941 CTTTGAGAGTCTGAGGTGGGAGG + Intergenic
1038696460 8:29811074-29811096 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1038765280 8:30422355-30422377 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1038945160 8:32351166-32351188 GTGTGAAAGTGAGAAGTGCAGGG - Intronic
1039329336 8:36519688-36519710 CTTTGGAAGGCTGAGGTGGATGG - Intergenic
1039411575 8:37359588-37359610 CTCTGGAAGGGTGTGGTGGATGG - Intergenic
1039938159 8:42066152-42066174 CTTTGGAAGGGTGAGGTGGGTGG - Intergenic
1040560077 8:48515829-48515851 CTGTGAGACTGTGAGTGGGAAGG - Intergenic
1041312968 8:56535168-56535190 CTCTGAGAGTGTGACATGGAAGG + Intergenic
1042012553 8:64264073-64264095 CTGTGAGAGTGTGTGGTGAAAGG - Intergenic
1042168306 8:65968194-65968216 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1042287615 8:67131276-67131298 ATTTGAAAGGCTGAGGTGGAAGG + Intronic
1042314718 8:67413394-67413416 CTTTGAAAGACTGAGGCGGATGG + Intergenic
1042770857 8:72380798-72380820 CAGTGACAGAGAGAGGTGGAGGG + Intergenic
1042936985 8:74069531-74069553 GTTTAAAAGTGTTAGGTGGATGG - Intergenic
1043108717 8:76150380-76150402 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1043374118 8:79628392-79628414 CTTTGGGAGTCTGAGGTGGACGG - Intronic
1043422322 8:80110960-80110982 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
1043424181 8:80132449-80132471 CTTTGGAAGCCTGAGGTGGATGG - Intronic
1043439460 8:80264210-80264232 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1043496318 8:80804671-80804693 CTGTCAGAGTGGGAGGTGGGAGG + Intronic
1043933600 8:86118315-86118337 CTTTGAAAGTCTGAGGCGGGTGG - Intronic
1044121137 8:88397587-88397609 CTGTTGATGTGTGAGGTGGAAGG - Intergenic
1044294695 8:90513871-90513893 CTGTCAGAGTGTGGGGTGGGAGG + Intergenic
1044652530 8:94512531-94512553 CTCTGAGAGGTTGAGGTGGAAGG + Intronic
1044783107 8:95763657-95763679 ATGTGCAAGTGTGTGGTGTATGG - Intergenic
1044897970 8:96913013-96913035 TTGTGCATGTGTGAGGTGGGAGG - Intronic
1044998908 8:97863187-97863209 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
1045131599 8:99160413-99160435 CTTTGAGAGTCTGAGGTGGGTGG + Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045425519 8:102062158-102062180 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1046102236 8:109628584-109628606 CTTTGAAAGGCTGAGGTGGAAGG - Intronic
1046531692 8:115454117-115454139 CTGTAAAATTGTGGGGTGTAGGG - Intronic
1047088188 8:121543118-121543140 CTTTGAGAGACTGAGGTGGAAGG - Intergenic
1047256182 8:123215125-123215147 CTGTGAAAGAGAGAGGAGGGGGG + Intergenic
1047885106 8:129241454-129241476 CTGTGACAGTCTGAAGAGGAAGG + Intergenic
1047967284 8:130055601-130055623 CTGTGAAAGTTTGAGACTGATGG + Intronic
1047976793 8:130138591-130138613 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1048017084 8:130507111-130507133 CTTTGAGAGGCTGAGGTGGATGG + Intergenic
1048022085 8:130548587-130548609 CTGTGAGAGGCTGAGGTGGGTGG - Intergenic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048706927 8:137164085-137164107 CTTTGGAAGGCTGAGGTGGACGG - Intergenic
1049320365 8:141993009-141993031 CTGTGCATATGTGGGGTGGAAGG - Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050360393 9:4825124-4825146 CTTTGGAAGGCTGAGGTGGATGG - Intronic
1050599934 9:7240131-7240153 CTTTGGAAGTCTGAGGTGGGAGG + Intergenic
1051800409 9:20926538-20926560 CTTTGGAAGTCTGAGGTGGGCGG + Intronic
1052903261 9:33813454-33813476 CTTTGAGAGTTTGAGGTGGGCGG + Intergenic
1052911123 9:33882843-33882865 CTTTGGGAGTCTGAGGTGGACGG + Intronic
1054787336 9:69221793-69221815 CTGTGAGAGATTCAGGTGGACGG - Intronic
1055000034 9:71438424-71438446 CTTTGAAAGGCTGAGGTGGAAGG + Intronic
1055043320 9:71898877-71898899 CTTTGCGAGTCTGAGGTGGATGG + Intronic
1055316161 9:75036467-75036489 CTTTGGAAGTCTGAGGTGGGAGG + Intergenic
1056307144 9:85301246-85301268 CTTTGAGAGGGTGAGATGGAAGG + Intergenic
1056399584 9:86213551-86213573 CTTTGGAAGGCTGAGGTGGACGG + Intergenic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1056713618 9:89010749-89010771 CTGAGAAAGTGTGGGGAAGAGGG + Intergenic
1056744949 9:89292668-89292690 CTGTGAGAGGCTGAGGTGGGCGG - Intergenic
1057296159 9:93843394-93843416 CTTTGGAAGTCTGAGGTGGGAGG + Intergenic
1058156065 9:101516932-101516954 CTTTGAAAGAGTGGTGTGGATGG + Intronic
1058255130 9:102752439-102752461 CTCTGACAGTGTTAGGTGGTTGG + Intergenic
1058625681 9:106930682-106930704 CTGTGAAGGTGAGAACTGGAAGG + Exonic
1058696365 9:107562535-107562557 CTCTGAAAGGCTGAGGTGGGAGG - Intergenic
1058738797 9:107921908-107921930 CTTTGGAAGGCTGAGGTGGACGG + Intergenic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1059934483 9:119295285-119295307 CTTTCAGAGTCTGAGGTGGATGG - Intronic
1060835334 9:126751423-126751445 CTGTGCAAGACTGTGGTGGATGG + Intergenic
1061063911 9:128265741-128265763 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1061293221 9:129664209-129664231 CTGTGGAAGGCTGAGGTGGGTGG - Intergenic
1061365447 9:130170665-130170687 CTTTGAGAGGCTGAGGTGGAAGG - Intergenic
1061438663 9:130583978-130584000 CTTTGAAAGACTGAGGTGGGAGG - Intronic
1061538636 9:131265490-131265512 CTGTGAGAGGCTGAGGTGGGTGG - Intronic
1061642010 9:131966117-131966139 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1061668527 9:132174676-132174698 CTGTGAGAGGCTGAGGTGGGCGG + Intronic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1203612064 Un_KI270749v1:18113-18135 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1185553906 X:1005384-1005406 CTTTGAGAGTCTGAGGTGGGCGG + Intergenic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1186208630 X:7226648-7226670 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1186344377 X:8676488-8676510 CTGTTGAAGTGTGAGGGGAAGGG + Intronic
1186404162 X:9287022-9287044 CTTTGGAAGGCTGAGGTGGAAGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186457562 X:9722014-9722036 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1187338392 X:18400469-18400491 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187690248 X:21858960-21858982 CTGTGAGAGGCTGAGGTGGGTGG + Intronic
1187690367 X:21860162-21860184 CTGTGAGAGGCTGAGGTGGGTGG + Intronic
1188788441 X:34377966-34377988 CTTTGAAAGCCTGAGGTGGGAGG + Intergenic
1190064692 X:47231811-47231833 TTATGAAATTGTGAGGGGGAAGG + Intergenic
1190077989 X:47332807-47332829 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1190186781 X:48242043-48242065 CTTTGAAAGGTTGAGGTGGACGG + Intronic
1190187407 X:48247645-48247667 CTTTGAAAGGTCGAGGTGGATGG - Intronic
1190201128 X:48362088-48362110 CTTTGAAAGGTCGAGGTGGACGG - Intergenic
1190202703 X:48377487-48377509 CTTTGAAAGGTCGAGGTGGATGG + Intergenic
1190207835 X:48417923-48417945 CTTTGAAAGGTCGAGGTGGATGG - Intergenic
1190210736 X:48444909-48444931 CTTTGAAAGGTTGAGGTGGATGG + Intergenic
1190385902 X:49881919-49881941 GTGGGAAAGTGTGGGGGGGAGGG + Exonic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190667958 X:52712548-52712570 CTTTGAAAGGTCGAGGTGGACGG - Intergenic
1190671459 X:52745856-52745878 CTTTGAAAGGTCGAGGTGGACGG + Intergenic
1190750232 X:53355914-53355936 CTGTGACATTGTGCAGTGGATGG - Intergenic
1191751849 X:64551179-64551201 ATGTGAAAGCCTGAGATGGAAGG + Intergenic
1192114312 X:68396187-68396209 CTTTGAGAGGCTGAGGTGGAAGG + Intronic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1194528772 X:95016325-95016347 CTGGGAGAGTGTGAGGAGCATGG - Intergenic
1195413908 X:104599489-104599511 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1195652605 X:107300846-107300868 CTGTTAAAACATGAGGTGGAGGG - Intergenic
1196703549 X:118697185-118697207 CTCTGGAAGGCTGAGGTGGAAGG + Intergenic
1197293828 X:124692761-124692783 CTTTGGGAGTCTGAGGTGGACGG + Intronic
1197322030 X:125044342-125044364 CTTTGCAAGGCTGAGGTGGAAGG + Intergenic
1197647762 X:129036448-129036470 CTGTGAAAGAATTGGGTGGAGGG - Intergenic
1197692612 X:129519730-129519752 GTCTGAAAGTGTGAGTTTGAGGG - Intronic
1198109734 X:133492448-133492470 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1198441082 X:136663879-136663901 GTGTGAAAGTGTGGTATGGAAGG - Intergenic
1198735292 X:139778098-139778120 CTTTGAAAGGTTGAGGTGGGAGG - Intronic
1200711602 Y:6489774-6489796 CTTTGAGAGTGTGAGGTAGTAGG - Intergenic
1200956894 Y:8958383-8958405 CTGTGAAAGGCTGAGGCGGGCGG + Intergenic
1201022332 Y:9672205-9672227 CTTTGAGAGTGTGAGGTAGTAGG + Intergenic
1201311370 Y:12600912-12600934 CTTTGAAAGTGTGTGGTAGTAGG + Intergenic
1201314632 Y:12631718-12631740 CTTTGAGAGGCTGAGGTGGATGG - Intergenic
1201402158 Y:13614894-13614916 CTGTGAGTCTGTGAGTTGGATGG - Intergenic
1201968178 Y:19761638-19761660 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1202107760 Y:21388008-21388030 CTTTGAGAGTCTGAGGTGGGTGG + Intergenic