ID: 1140220926

View in Genome Browser
Species Human (GRCh38)
Location 16:73043289-73043311
Sequence CCCTCTCCCTGTCCATCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 2, 1: 0, 2: 3, 3: 31, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140220926_1140220934 6 Left 1140220926 16:73043289-73043311 CCCTCTGATGGACAGGGAGAGGG 0: 2
1: 0
2: 3
3: 31
4: 291
Right 1140220934 16:73043318-73043340 CCAAAAGGCAGATGAAGCCCAGG 0: 1
1: 0
2: 1
3: 31
4: 290
1140220926_1140220935 21 Left 1140220926 16:73043289-73043311 CCCTCTGATGGACAGGGAGAGGG 0: 2
1: 0
2: 3
3: 31
4: 291
Right 1140220935 16:73043333-73043355 AGCCCAGGCATTTTGCTAAGAGG 0: 1
1: 0
2: 0
3: 17
4: 157
1140220926_1140220938 26 Left 1140220926 16:73043289-73043311 CCCTCTGATGGACAGGGAGAGGG 0: 2
1: 0
2: 3
3: 31
4: 291
Right 1140220938 16:73043338-73043360 AGGCATTTTGCTAAGAGGCCCGG 0: 1
1: 0
2: 4
3: 14
4: 188
1140220926_1140220939 27 Left 1140220926 16:73043289-73043311 CCCTCTGATGGACAGGGAGAGGG 0: 2
1: 0
2: 3
3: 31
4: 291
Right 1140220939 16:73043339-73043361 GGCATTTTGCTAAGAGGCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 357
1140220926_1140220931 -9 Left 1140220926 16:73043289-73043311 CCCTCTGATGGACAGGGAGAGGG 0: 2
1: 0
2: 3
3: 31
4: 291
Right 1140220931 16:73043303-73043325 GGGAGAGGGGGTCACCCAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140220926 Original CRISPR CCCTCTCCCTGTCCATCAGA GGG (reversed) Intronic
900089471 1:913561-913583 CCCTCTGCCTGTTCATCTGAGGG + Intergenic
901325247 1:8361447-8361469 CTCTCTCCCTCACCTTCAGATGG + Exonic
901343631 1:8518397-8518419 CTCTCTCCCTGTCCTTCAGATGG + Intronic
903217121 1:21849369-21849391 CACTGTCCCTGTCCTTCACATGG + Intronic
903264690 1:22150799-22150821 GCCCCTCCCTGCCCAGCAGAAGG + Intergenic
903697281 1:25217242-25217264 CCCTCTCCCTGTTTTGCAGATGG - Intergenic
903702487 1:25260713-25260735 CTCTCTCCCTGTCTTGCAGATGG + Intronic
903711725 1:25330867-25330889 CTCTCTCCCTGTCTTGCAGATGG + Intronic
903921797 1:26804840-26804862 CCCTCTCCCTCTCCTTTCGACGG - Intergenic
904818168 1:33220967-33220989 CCCTTGCCCTGTCAATCTGATGG - Intergenic
906210122 1:44008228-44008250 CCCTCTCCCAGCCCAGCAGCGGG + Intronic
907302304 1:53496015-53496037 CCATCTCCCTATCTGTCAGATGG + Intergenic
907454942 1:54569439-54569461 CCCCCTCACTGTCCCTCCGACGG + Intronic
907676551 1:56522936-56522958 CCCTCTGTCTGTCCAGCAGCTGG + Intronic
907726687 1:57026776-57026798 CTCTCTCCCCATCCATCATATGG + Intronic
908110773 1:60895242-60895264 CTCTCTCCCTGTCCCTCTCATGG + Intronic
911682635 1:100735127-100735149 CCCTCTTCCTTTCTACCAGAAGG + Intronic
912419907 1:109535898-109535920 CCCACCTCCTGTCCATCAGCAGG - Intergenic
913260080 1:116989832-116989854 CCCTCACCCTCACCATCTGAGGG + Exonic
913415280 1:118598685-118598707 CCCACTGTCTCTCCATCAGAGGG + Intergenic
915317616 1:155038117-155038139 TCCTCTCCCTGTTCTTCACATGG - Intronic
915594270 1:156887479-156887501 TCCTCTCCCAGCCCAGCAGAGGG - Intergenic
917269323 1:173256342-173256364 CCCTCTTCCTGGCCTGCAGATGG + Intergenic
919569738 1:199232772-199232794 CCATCTGCCTGTCTATTAGAAGG + Intergenic
920035417 1:203061978-203062000 TCCTCTCCCTGTCCCTCTCAGGG + Intronic
920096782 1:203491715-203491737 CTCTCTCCCTATCCATGAAAAGG + Intergenic
920417796 1:205810362-205810384 GCCTCTCCCTGCTCTTCAGATGG - Exonic
1063127661 10:3150021-3150043 ACCTCTCCCCGTCAACCAGAGGG + Intronic
1065047136 10:21754600-21754622 CCCTCTCCCTGTCCCTCTCCAGG + Intergenic
1066311410 10:34200565-34200587 CCCTCTGCCCATCCATCACATGG + Intronic
1067241537 10:44499281-44499303 TCCTCTCCCTGTGCCTCATATGG + Intergenic
1068629388 10:59284345-59284367 CTCTCTCCCTCTCCACGAGAAGG + Intronic
1069638059 10:69937616-69937638 CCCTCTCCCTTTCCTCCAGGGGG + Exonic
1070363226 10:75711214-75711236 CCAACTCCTTGTCCAACAGATGG - Intronic
1070644950 10:78195379-78195401 CTCCCTCCCTGGCCTTCAGAAGG + Intergenic
1071017658 10:81017447-81017469 TCCTCTCCTTGTCCTGCAGATGG + Intergenic
1071467514 10:85955165-85955187 CCATCTCCCTGTCCCTTGGATGG + Intronic
1071878601 10:89869797-89869819 CCCTGTCCTTGTCTACCAGATGG + Intergenic
1072944507 10:99797898-99797920 CCCTCTGACTGTCCCTCAGAGGG - Intronic
1073161456 10:101400553-101400575 TCCTCTCCCTATCAATGAGAAGG + Intronic
1074694914 10:116041657-116041679 CCCTTGCTCTGTCCATGAGAAGG - Intergenic
1075709851 10:124525214-124525236 CTCTCTGCCCGTCCCTCAGAGGG + Intronic
1076071419 10:127493039-127493061 CACTCACCCTGGCCGTCAGAGGG + Intergenic
1076713319 10:132350952-132350974 CCCTCTCCCTGCCCATGAGAGGG - Intronic
1077603532 11:3591357-3591379 CCGTCTCACTGTCTATCAGCTGG + Intergenic
1079111030 11:17605318-17605340 CCCTCTCCCTATCTATGAGTTGG + Intronic
1079408701 11:20166589-20166611 CTCACTCCCTGTACTTCAGAAGG + Intergenic
1080406537 11:31985045-31985067 TCCTCTCCATGTCCACCAGCTGG + Intronic
1080454309 11:32404363-32404385 CCTTCTCCCTGTCATTCAGCAGG - Intronic
1080837129 11:35949500-35949522 CCTTCTCCCTTGCCATCAAAAGG + Intronic
1083675453 11:64322562-64322584 CCCTCTCCCTGTCCATCAGATGG - Intergenic
1083705434 11:64510974-64510996 CCCTCTCCCTGTCCCTGGGAGGG + Intergenic
1083809783 11:65097021-65097043 CCGTCTCACTGTCCATCAACTGG - Exonic
1084259431 11:67965953-67965975 CCGTCTCACTGTCCATCAGCTGG + Intergenic
1084670408 11:70603448-70603470 CCCTGACCCTGTCCAGCAGCTGG + Intronic
1084813339 11:71629297-71629319 CCGTCTCACTGTCGATCAGCTGG - Intergenic
1087692406 11:101336875-101336897 CCCTGCCCTGGTCCATCAGAGGG - Intergenic
1089727421 11:120494700-120494722 CCCTCTCCCTATGCATAGGAGGG - Intergenic
1090968363 11:131617919-131617941 CCCCCTCCCTGTCCATCTCAAGG - Intronic
1091179217 11:133588429-133588451 CCCCCACCATGTGCATCAGAAGG - Intergenic
1092086557 12:5767790-5767812 CCCTCCACTTTTCCATCAGAAGG - Intronic
1092430742 12:8406917-8406939 CCGTCTCACTGTCTATCAGCTGG + Intergenic
1092617875 12:10232094-10232116 CCCTCTTTCTGTCCATGAGCTGG + Intergenic
1092668570 12:10835952-10835974 CCCTCTCTCTCTCCTTCACAGGG - Intronic
1095801907 12:46278023-46278045 CCTTCAGCCTGTACATCAGATGG - Intergenic
1096001655 12:48135259-48135281 CCCTCTCTCTGTCCCTCTGTTGG + Intronic
1096277500 12:50222650-50222672 CCCTCTCCCTCTCCCTCTGCCGG - Intronic
1098888703 12:75986004-75986026 CCCTCTAATTTTCCATCAGAGGG + Intergenic
1100658987 12:96676905-96676927 CCCTCTCCCTGGCTCGCAGACGG - Intronic
1103019799 12:117524976-117524998 CCCTCTCAATGTCAATCAGCCGG + Exonic
1103715515 12:122943152-122943174 CCAGCTCCCTGGCCCTCAGATGG + Intronic
1103863809 12:124035307-124035329 TGCTCTCCCTGTTCATGAGAAGG - Intronic
1105427414 13:20306160-20306182 CCCTCTCGCTGTCCTTCACAAGG - Intergenic
1105770623 13:23608441-23608463 CAGTTTCCCTGTCCATAAGATGG - Intronic
1106401350 13:29434282-29434304 ACCTCTCTCAGCCCATCAGATGG - Intronic
1107520125 13:41171971-41171993 CCCTCTCCCCCTCCCTGAGACGG - Intergenic
1108186528 13:47893434-47893456 CCCTCTCCTTGGCCTGCAGATGG - Intergenic
1110236881 13:73226235-73226257 CCCTCTCCCTGGCTTGCAGATGG + Intergenic
1110677231 13:78263251-78263273 CCCTCTTCCTGGCTTTCAGATGG - Intergenic
1111319001 13:86599615-86599637 CTCTCTCCCTGTCTTGCAGACGG + Intergenic
1112329392 13:98465271-98465293 CTCCCTCCCTGTCCATCCAAGGG + Intronic
1112506420 13:99979063-99979085 CCCTCTCTCTGTGCATAAAAGGG - Intergenic
1114711861 14:24786829-24786851 CCCTCTCACTGTCCATCTAGTGG + Intergenic
1114746634 14:25155476-25155498 CCCTGGCCCAGTCCCTCAGATGG + Intergenic
1116446785 14:45020737-45020759 CCAACTCCCAGTGCATCAGATGG - Intronic
1118316238 14:64727852-64727874 CCCTCTCCCCGTTCAACAGCCGG + Exonic
1119251848 14:73162452-73162474 CTCTCTCTCTCTCCATGAGAAGG + Intronic
1121700625 14:95951314-95951336 CCCTTTCCCACTCCAGCAGAGGG - Intergenic
1121907995 14:97765030-97765052 CCCTCTCCTAATCCATCTGAGGG - Intergenic
1122026845 14:98884286-98884308 CTCTCTCCCTGTCTTGCAGACGG - Intergenic
1122309730 14:100786844-100786866 ACTTCTCCCTGTCTATCAGCAGG + Intergenic
1122659247 14:103283636-103283658 AGCACTTCCTGTCCATCAGATGG - Intergenic
1122806724 14:104263461-104263483 CCCCCACCCTGTCCTTCAGGTGG - Intergenic
1123067408 14:105625606-105625628 CCCTCTCCCTGAGCATGAGTGGG + Intergenic
1123071424 14:105644330-105644352 CCCTCTCCCTGAGCATGAGTGGG + Intergenic
1123076382 14:105669385-105669407 CCCTCTCCCTGAGCATGAGTGGG + Intergenic
1123091087 14:105742611-105742633 CCCTCTCCCTGAGCATGAGTGGG + Intergenic
1123096854 14:105770946-105770968 CCCTCTCCCTGAGCATGAGTGGG + Intergenic
1123776662 15:23587603-23587625 CCTTCTCCCTGAACAACAGAAGG + Intronic
1124034171 15:26038879-26038901 CCCTCTCCCTGGCAGGCAGATGG - Intergenic
1126539652 15:49807910-49807932 CCCCTTCCCTGTCCATCAAAGGG + Intergenic
1128737457 15:70061292-70061314 TCCTTTCCCTGTCTGTCAGAGGG - Intronic
1129771619 15:78206621-78206643 CCTTCTCCCTGTCCCTCATCTGG + Intronic
1131091063 15:89625279-89625301 CCCTCTCCATTTCAAACAGATGG + Exonic
1131395061 15:92079438-92079460 CTCTCTCCTTGGCCAGCAGACGG + Intronic
1131762814 15:95642669-95642691 CCCTCTTCCTGGCCTGCAGATGG + Intergenic
1131826901 15:96329697-96329719 GCCTCCTCCTGTCCATCAGTGGG + Intronic
1131875978 15:96806933-96806955 CTCTCTCCCTGGCCTGCAGATGG - Intergenic
1131989304 15:98077713-98077735 CCCTCTGCCTCTGCCTCAGAGGG + Intergenic
1132025705 15:98402938-98402960 CCCTCTCTCTGTCTTGCAGACGG + Intergenic
1132219675 15:100096035-100096057 TTCTCTGCCTGTGCATCAGAAGG + Intronic
1132405174 15:101537451-101537473 CCCTCTCCCTTGCCATCTGATGG + Intergenic
1132465713 16:76634-76656 TCCTCTCCCTGCCCATCAAGAGG + Intergenic
1132539131 16:500090-500112 TTCTGTCCCTGTCCATGAGATGG + Intronic
1132568753 16:635056-635078 CCCCCTCCCTGTCCCCAAGAGGG + Intronic
1134303903 16:13014953-13014975 CCCACTCAATGTCCAGCAGAGGG + Intronic
1135503272 16:23015340-23015362 CCAGCCTCCTGTCCATCAGAGGG - Intergenic
1135822470 16:25696229-25696251 CCCTCTCCCTTTCCAAAAAAAGG + Intronic
1137570022 16:49559156-49559178 CGCTTTCTCTGTCCATGAGATGG - Intronic
1137730178 16:50683900-50683922 GCCTCCCCCTGCCCAGCAGAGGG + Intergenic
1139095123 16:63696192-63696214 CCCTCTACCTGTAGCTCAGAGGG + Intergenic
1139933646 16:70550825-70550847 CCATCTGCCTGTGCATCAGATGG + Intronic
1140220926 16:73043289-73043311 CCCTCTCCCTGTCCATCAGAGGG - Intronic
1140262199 16:73390163-73390185 CCCTCTACCTGTTCCTCAGGTGG + Intergenic
1140407295 16:74719261-74719283 CCCTGTAGCTGTCCAACAGAGGG - Intronic
1140973838 16:80040426-80040448 TCCTCTTCCTGTTCATCATATGG + Intergenic
1141618653 16:85224654-85224676 CCCCCTCCCCTGCCATCAGAAGG - Intergenic
1141759447 16:86018215-86018237 ACCTCTCCCTCTCCTCCAGAAGG - Intergenic
1142069196 16:88081059-88081081 CCCTCTCCCGTTCCCTGAGATGG + Intronic
1142526464 17:545288-545310 CCCTCTCCTTGTCTAGCAGCAGG + Intronic
1143767736 17:9148749-9148771 CCCTGTCCCTGTCCACGAGCAGG + Intronic
1144441509 17:15286836-15286858 CTCTCTCCCTGGCCTGCAGATGG + Intergenic
1144621626 17:16822147-16822169 CCTTCTCACTGCCCACCAGAAGG + Intergenic
1147930422 17:43977164-43977186 CCCTCTCCCTGCCCCGCTGAAGG - Intronic
1149083328 17:52684372-52684394 CCCTCTCCCTGACGTTAAGAAGG + Intergenic
1150250607 17:63702307-63702329 CCTTCTCCCAGTCCCTCAGGGGG - Intergenic
1151717202 17:75836936-75836958 CCTCCTCCCTGTCCAGCTGAGGG - Intronic
1151954733 17:77374567-77374589 CCCCCTCCCGGCCCACCAGAGGG - Intronic
1152018469 17:77767813-77767835 CTCTCTCTCTGTCCCTGAGATGG - Intergenic
1154110462 18:11563926-11563948 CCCTCTGCCTCTCTATGAGAAGG - Intergenic
1157126016 18:44956840-44956862 TTCTCTCCCTGCCCAGCAGATGG + Intronic
1158844305 18:61425446-61425468 CTCTCTCACTGCCCCTCAGACGG + Intronic
1159990638 18:74902913-74902935 CCCTCTACCTCTCCATGGGATGG + Intronic
1161318734 19:3631403-3631425 CCCCCGCCCTGTCCCTCCGAAGG - Exonic
1161663899 19:5563408-5563430 CCCTCTATCTGTCCTTCAGCTGG - Intergenic
1162088346 19:8261911-8261933 CCCTCTCTCTGTTCCCCAGATGG + Exonic
1162578727 19:11514634-11514656 TCCTCACCCTGTCCAGCAGCTGG + Intronic
1163251586 19:16129084-16129106 CTTTTTCCCTGACCATCAGAAGG + Intronic
1163583984 19:18154190-18154212 CCCTAGCCCTGTCCATCACAGGG + Intronic
1164089936 19:21940798-21940820 CCACCTCCCCTTCCATCAGAGGG - Intronic
1164109349 19:22140374-22140396 CCACCTCCCCTTCCATCAGAGGG - Intergenic
1164130162 19:22354702-22354724 CCACCTCCCTTTCCATCAAAGGG - Intergenic
1165485455 19:36092821-36092843 GCCCCTGCCTGTCCACCAGAGGG + Intronic
1166433038 19:42742213-42742235 TTCCCTCCCTGTCCACCAGAGGG - Intronic
1166436139 19:42767439-42767461 TTCCCTCCCTGTCCACCAGAGGG - Intronic
1166446016 19:42857467-42857489 TTCCCTCCCTGTCCACCAGAGGG - Intronic
1166448996 19:42881427-42881449 TTCCCTCCCTGTCCACCAGAGGG - Intronic
1166453398 19:42919619-42919641 TTCCCTCCCTGTCCACCAGAGGG - Intronic
1166455882 19:42938928-42938950 TTCCCTCCCTGTCCAACAGAGGG - Intronic
1166465678 19:43028203-43028225 TTCCCTCCCTGTCCACCAGAAGG - Intronic
1166485431 19:43207355-43207377 TTCCCTCCCTGTCCACCAGAGGG - Intergenic
1166492584 19:43271275-43271297 TTCCCTCCCTGTCCACCAGAGGG - Intergenic
1166995376 19:46717346-46717368 TCCCCTCCCTGTCCAGCCGAGGG - Intergenic
1168147549 19:54428525-54428547 CCTTCTCCCTGTTTAACAGAGGG + Intronic
928201266 2:29249204-29249226 CCTGCTCCCTGTCCCACAGAGGG - Intronic
928310375 2:30204768-30204790 CCCACTCCCTGTCTCTGAGATGG - Intergenic
928322791 2:30296497-30296519 CCCTCTCCAGGAACATCAGAGGG - Intronic
929565056 2:42978859-42978881 CCTCCTCCCTGTCCTTCTGAGGG - Intergenic
929609149 2:43257064-43257086 ACCTCTACCTGTCTACCAGATGG - Intronic
930314482 2:49780877-49780899 GACTCTCCCTGTCTTTCAGAAGG - Intergenic
931531579 2:63220852-63220874 CCCTCCCCCTGCCCACCAAAAGG + Intronic
932008470 2:67951746-67951768 CTCTCTCTCTGTCACTCAGATGG - Intergenic
932162105 2:69470042-69470064 CCCTCACTATGTCAATCAGATGG - Exonic
932206683 2:69889573-69889595 CCCTCTGCCTGTCCCTTATAAGG + Intergenic
932830538 2:74985461-74985483 CCCTCTCTCTTCCCATCACAGGG + Intergenic
933594483 2:84269131-84269153 CCCTCTCCCTGTCCAAAATCAGG + Intergenic
934639161 2:96016487-96016509 CCCTCTCCCTGCCCTTCACATGG + Intergenic
934794484 2:97088924-97088946 CCCTCTCCCTGCCCTTCACATGG - Intronic
935552141 2:104468945-104468967 ACCTGTCCCAGTCCAACAGAAGG + Intergenic
937846011 2:126579737-126579759 CACTCTCCCTGTCCATCCTGAGG + Intergenic
939604272 2:144234532-144234554 GCTTCTCCCTGCCAATCAGAAGG + Intronic
943411553 2:187555887-187555909 CCCTCTCCCTCTCCCTCTCACGG + Intronic
943636680 2:190314914-190314936 CCCTCTTCCTCTCCACCAGATGG - Intronic
944508589 2:200441711-200441733 CCCTCTCTCAGATCATCAGAGGG - Intronic
945916980 2:215714537-215714559 CCAGTTCCCTGTCCATCCGAAGG - Intergenic
946312072 2:218887601-218887623 CCCTCTCTCTTTCCATCTCATGG - Intronic
946403516 2:219481106-219481128 CCACCTCCCTGCCCATCAGGGGG + Intronic
947750469 2:232529425-232529447 CACTTGCCCTGTCCATCAGAAGG + Intronic
948630913 2:239302218-239302240 CCGCCTGCCTGTCCATCACAAGG - Intronic
948741140 2:240046678-240046700 CCTTATCCCTGTCAATCTGAGGG + Intergenic
1168875875 20:1171839-1171861 CCCTCTCCCTCTCCTTCAGAAGG + Intronic
1170333416 20:15240866-15240888 CTCTCTTCCTGTCTTTCAGAAGG - Intronic
1172123089 20:32609861-32609883 CCCCCTCACTCTCCATCTGAGGG + Intergenic
1172854969 20:37994682-37994704 CCCCCTCCCTGCCCATCAGGAGG + Intronic
1173042277 20:39475573-39475595 CTCTCTCCCTGTCTTGCAGATGG + Intergenic
1174566481 20:51468518-51468540 CTTTCTCCCTGCCCAGCAGATGG - Intronic
1174800858 20:53562144-53562166 ACCTCTGCCTGTCCAGCAGCTGG - Intergenic
1175769012 20:61611213-61611235 TCCTCTCCCTGGGGATCAGAGGG + Intronic
1179138529 21:38701502-38701524 CCCTTTCCTTGTCCATGTGATGG - Intergenic
1180706855 22:17815564-17815586 CACTCTCCCTGTCCCTGAGAAGG + Intronic
1181536632 22:23549563-23549585 CCCTTTCCCTGACCATCCCAAGG + Intergenic
1182080246 22:27523732-27523754 CCCACCCCCTGCCCACCAGATGG - Intergenic
1182768709 22:32777648-32777670 CTCTCTCCCTGTAAATCTGAGGG - Intronic
1182939805 22:34264700-34264722 CCCCCTCTATGTCCATGAGATGG - Intergenic
1183103451 22:35598208-35598230 TCCTCTCCCTGGCCCTCAGAAGG - Intergenic
1183351449 22:37336898-37336920 ACCTCTCCCTGTCCTTGAGCCGG - Intergenic
1183523600 22:38310731-38310753 CCTTCTCCCTCTGCATCATAAGG - Intronic
1184280817 22:43436467-43436489 CCCTCTGCCTGCCAAACAGAAGG - Intronic
1184666510 22:45992174-45992196 CCCTCTGCCTGTCCCTCATCTGG - Intergenic
1184737473 22:46407919-46407941 CCCTCTGCCTGTGCATCTGAAGG - Intronic
1185151975 22:49169010-49169032 GCCTCTCCCTGCCTAGCAGACGG - Intergenic
1185246234 22:49774773-49774795 CCCACACCTTGTCCATCCGAGGG - Intronic
950071453 3:10156128-10156150 CTCTCTCCCTGTCTGTCAGAAGG + Intergenic
950931679 3:16795729-16795751 CTCTCTCCCTGTCTTGCAGATGG + Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953436665 3:42882582-42882604 TTCTCTGCCTGTCCATCTGATGG + Intronic
953557170 3:43955555-43955577 CCCTCTCCGTGTCCAGTAGCTGG + Intergenic
953648960 3:44782540-44782562 CCCTCTGCCTGAGAATCAGAAGG - Intronic
953666098 3:44927701-44927723 CCCTCTCTCTCTTCTTCAGATGG + Intronic
957074385 3:75590382-75590404 CTGTCTCACTGTCCATCAGCTGG + Intergenic
957791687 3:84949788-84949810 CCCTCTCCCTCTCCCTAAGCTGG - Intergenic
959582657 3:107997754-107997776 TCCTCTTCCTGTCCATCATCAGG + Intergenic
960127626 3:114017686-114017708 CCCTCTCTGTGTCCATGTGAAGG - Intronic
961151424 3:124641712-124641734 CCCTTTCCCTGTCCTTCACAAGG - Intronic
961279712 3:125756338-125756360 CCGTCTCACTGTCCATCAGCTGG - Intergenic
961323873 3:126098330-126098352 CTCTCTCCCTGTCTTGCAGATGG - Intronic
961874685 3:130013267-130013289 CCGTCTCACTGTCCATCAGCTGG + Intergenic
963010793 3:140768392-140768414 CCTTCTCCCTGTACCTCACATGG - Intergenic
963314793 3:143747519-143747541 CTCTCTGCCTGTACATCATAAGG - Intronic
965669472 3:171131823-171131845 CTTTCTCTCTGTCCATCTGAAGG - Intronic
966949180 3:184800710-184800732 CGCTTTCCCTTCCCATCAGAAGG + Intergenic
969017996 4:4118010-4118032 CTGTCTCACTGTCCATCAGCTGG + Intergenic
969074732 4:4568933-4568955 CTCTCACAGTGTCCATCAGAAGG - Intergenic
969304361 4:6317350-6317372 CCCTCTCCCAGCCCTGCAGAAGG - Intergenic
969735998 4:8990703-8990725 CCGTCTCACTGTCCATCAGCTGG - Intergenic
969795206 4:9522162-9522184 CTGTCTCACTGTCCATCAGCTGG - Intergenic
974088867 4:57289665-57289687 CCCTCTCCTTGGCCTGCAGATGG - Intergenic
974094359 4:57346353-57346375 CCCTCTCACTGTCTTCCAGAGGG - Intergenic
975546731 4:75568061-75568083 CTCTCTCCCTGTCTTGCAGATGG + Intergenic
981022823 4:140047047-140047069 CCTTCTCCCAGTCTCTCAGACGG - Intronic
981887857 4:149699517-149699539 GCCTCTATCTTTCCATCAGATGG - Intergenic
984850279 4:184146723-184146745 GCCTCTCCCTGCCTCTCAGATGG + Intronic
986633896 5:9801238-9801260 CCCTCTTCCTGTCCTGCAGATGG - Intergenic
987165470 5:15193717-15193739 CTCTCTCCCTGTCTTGCAGATGG - Intergenic
991086122 5:62649642-62649664 CCCTCTTCCTGGCCTGCAGATGG - Intergenic
992362318 5:76052589-76052611 CCAGCACCCTGGCCATCAGACGG - Intergenic
992689023 5:79225436-79225458 TCCTCTCCCTCTCCTTCATATGG + Intronic
994588152 5:101738010-101738032 CCATCCCTCTGTTCATCAGATGG - Intergenic
994728197 5:103461364-103461386 CCCTGTCCAAGTCCATCAAATGG - Intergenic
997241086 5:132308793-132308815 CCCTCTCCCTGCCCCTCTGATGG - Intronic
1000100537 5:158012238-158012260 CCATCTACTTCTCCATCAGAAGG - Intergenic
1001056236 5:168452486-168452508 CCCTTTCCCTGGCTAGCAGATGG - Intronic
1001315854 5:170640878-170640900 CCCATTCACTGTGCATCAGAAGG - Intronic
1002185528 5:177453097-177453119 CTATCTCCCTGTCTATCAAATGG + Intronic
1002290054 5:178194285-178194307 CCTTCTCCCTGCACAGCAGAGGG - Intergenic
1002852385 6:1007978-1008000 CACTCTCCCTGTCCCTAGGATGG - Intergenic
1003567130 6:7231004-7231026 CCCTCTCCCTGCCCAGCACCCGG + Exonic
1004275829 6:14234306-14234328 TCCTCTCTCTGGCCACCAGACGG + Intergenic
1007189294 6:39999681-39999703 CACCCTCTCTGTCCATCAGTTGG + Intergenic
1007367017 6:41401640-41401662 CTCTCTCTCTCTCCATCACATGG + Intergenic
1010241440 6:73619397-73619419 CACCCTGCCTGGCCATCAGATGG - Intronic
1014531913 6:122569083-122569105 CCCTCTCCTTGACCCTCATAGGG + Intronic
1015042372 6:128737895-128737917 ACCTTTCCTTGCCCATCAGAAGG + Intergenic
1015482616 6:133729902-133729924 GCCTCTACCTGCCCATCATATGG - Intergenic
1019136369 6:169911183-169911205 CCTTCTCCCTGCCCAGCAAAAGG - Intergenic
1019335190 7:479327-479349 ACCACTACCTGGCCATCAGACGG - Intergenic
1019500020 7:1360126-1360148 TCCTCTGCTGGTCCATCAGATGG + Intergenic
1019540939 7:1550696-1550718 CACTCTCCCGGCCCGTCAGAGGG - Intronic
1020614347 7:10440088-10440110 CCCTCTTCCTGGCCTACAGAGGG + Intergenic
1021542778 7:21778547-21778569 GCCTCTCACTGTCCAACAGAAGG - Intronic
1022244960 7:28550379-28550401 CAATCTCCCTGTCCCTTAGAAGG - Intronic
1022832018 7:34077160-34077182 CTCTCTCCCTGGCCATGAAATGG - Intronic
1023557022 7:41434614-41434636 TCCTCTCCCTATGCCTCAGATGG + Intergenic
1024972667 7:55085057-55085079 CCCAGTCCTTGTCCTTCAGATGG + Intronic
1026479104 7:70763376-70763398 CCCTCTCCCTGGGGATCAGGTGG + Intronic
1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG + Intronic
1029076438 7:97938519-97938541 CCGTCTCACTGTCCATCAGCTGG + Intergenic
1031772627 7:125864007-125864029 CCCTTTACCTGTCTATCAGTGGG - Intergenic
1032072596 7:128817885-128817907 CCCTCCCTCTATCCCTCAGAAGG - Intronic
1032327345 7:130942542-130942564 CCCTCTCCCTGCCCAAGAAACGG + Intergenic
1032379929 7:131468061-131468083 TCCTCTGCCTGTCCCTCAAATGG - Intronic
1032536973 7:132672490-132672512 CCCTATCCCTTCCCATCTGAAGG - Intronic
1033544631 7:142389007-142389029 CTCCCTCCCTGTCCAGCAGAAGG - Intergenic
1034338127 7:150336546-150336568 CCCCATCCCTGTCACTCAGATGG + Intronic
1036241303 8:7083223-7083245 CCGTCTCACTGTCCATCAGCTGG - Intergenic
1036260758 8:7238357-7238379 CCGTCTCACTATCCATCAGCTGG + Intergenic
1036305847 8:7601174-7601196 CCGTCTCACTATCCATCAGCTGG - Intergenic
1036312794 8:7696901-7696923 CCGTCTCACTATCCATCAGCTGG + Intergenic
1036356695 8:8049171-8049193 CCGTCTCACTATCCATCAGCTGG - Intergenic
1036831649 8:12025323-12025345 CCGTCTCACAGTCCATCAGCTGG + Intergenic
1036901872 8:12676113-12676135 CCGTCTCACTGTCCATCAGCTGG + Intergenic
1038208725 8:25494921-25494943 CTCTCTCCTTGGCCTTCAGATGG - Intronic
1039951363 8:42175435-42175457 CCCACTCCCTGGCTCTCAGAAGG - Exonic
1040698836 8:50036571-50036593 CTTTCTGCCTGTCCATCAGGAGG - Intronic
1041446427 8:57955743-57955765 TTCTCTCCCTGTCCATGAGGTGG - Intergenic
1044608630 8:94070189-94070211 TCCTCTCTCTGTCCATGAGATGG - Intergenic
1046289438 8:112137550-112137572 CCCTCTCCTAGGCCTTCAGAGGG + Intergenic
1047148725 8:122236403-122236425 CACTCTACCTGGCCAGCAGAGGG - Intergenic
1047247563 8:123158499-123158521 CCCACTCCCTGTCCTTCCGTCGG - Intergenic
1049408459 8:142461987-142462009 GCCGCTCCCTCTCCATGAGATGG + Intronic
1049461698 8:142732491-142732513 CCCACTCACTGTCCAGCAGGAGG + Intronic
1049571101 8:143370691-143370713 TACTCACCCTGTTCATCAGACGG - Intronic
1049606820 8:143533402-143533424 CCCCCTGCCTGTTCCTCAGAAGG + Intronic
1049971626 9:826700-826722 ACCACTCCCTGTCAATCAGTGGG + Intergenic
1050145931 9:2567563-2567585 CCCTCTCCCTGTCTTGTAGATGG - Intergenic
1050466675 9:5933485-5933507 CCAGCTCCCTTTCCATAAGATGG + Intronic
1052796894 9:32931285-32931307 CCCTCCTCCTTCCCATCAGAGGG + Intergenic
1053004735 9:34596950-34596972 CCCTCTCCCTGTCCCTCTTCTGG - Intergenic
1054255826 9:62811321-62811343 CACTTTCCCTCTCCATCACATGG + Intergenic
1054335485 9:63804287-63804309 CACTTTCCCTCTCCATCACATGG - Intergenic
1054996149 9:71392611-71392633 CCCTATGCCTCTCTATCAGAAGG + Intronic
1055994163 9:82139619-82139641 TTCTCTACCTGTCCTTCAGATGG + Intergenic
1056756389 9:89384729-89384751 CCCTCCCCCTGTCCTACAGCTGG - Intronic
1059199801 9:112403853-112403875 CCCTCCCCATGCCCATCTGATGG - Intronic
1059972520 9:119682215-119682237 CCCTCTATGTGTCCATCAAAAGG + Intergenic
1060666521 9:125435322-125435344 CCCTCACCATGTCCCTCTGAAGG + Intergenic
1061245201 9:129398125-129398147 CCCTTTCCCTGACCATCCCAAGG - Intergenic
1062554842 9:137109308-137109330 GCCTCTCCCTGCCCACCAGCAGG - Intergenic
1185821365 X:3207884-3207906 CCCCCTACCTGTACAGCAGATGG - Intergenic
1186144858 X:6614621-6614643 CTCAGTGCCTGTCCATCAGAGGG + Intergenic
1189494829 X:41499584-41499606 CAGTGTCCCTGTCCATGAGATGG - Intergenic
1190358910 X:49631026-49631048 CCCTTCCCCTGTCCACCAAAAGG - Intergenic
1198991966 X:142525037-142525059 CCCTCTCTCTGTCCATTTCAGGG - Intergenic
1199910458 X:152281250-152281272 CCCTCTTCCTATACATCTGATGG + Intronic
1201257518 Y:12123821-12123843 CCCCCTACCTGTACAGCAGATGG + Intergenic
1202343014 Y:23889018-23889040 CCCTGTCCCTTTCAATCAGCTGG - Intergenic
1202527754 Y:25781067-25781089 CCCTGTCCCTTTCAATCAGCTGG + Intergenic