ID: 1140222843

View in Genome Browser
Species Human (GRCh38)
Location 16:73056807-73056829
Sequence ACTGCCCAAGCCTCTTTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140222835_1140222843 21 Left 1140222835 16:73056763-73056785 CCCTATTGATTATGCAGATTGTG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1140222843 16:73056807-73056829 ACTGCCCAAGCCTCTTTCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 67
1140222836_1140222843 20 Left 1140222836 16:73056764-73056786 CCTATTGATTATGCAGATTGTGA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1140222843 16:73056807-73056829 ACTGCCCAAGCCTCTTTCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140222843 Original CRISPR ACTGCCCAAGCCTCTTTCGG AGG Intronic
905463202 1:38134659-38134681 ACTGCCCCCTCCCCTTTCGGTGG + Intergenic
906669723 1:47645630-47645652 ACTGCTCCAGCCTCTTTCCTGGG - Intergenic
910412387 1:86960839-86960861 ACTGCCCAAGTGTCTTTTGAAGG - Intronic
921264621 1:213411914-213411936 ACTCACCAAGCCTCTTGCTGTGG - Intergenic
924381096 1:243465216-243465238 CCTGCCCAAGCCTGCTTCAGTGG + Intronic
1064105885 10:12500683-12500705 AATGCCCAAGCCTCTTTAGCTGG - Intronic
1074019817 10:109570822-109570844 ACTTCCCAAGGCTGTTTCTGTGG - Intergenic
1074102889 10:110367493-110367515 ACTGCCCAGGCTTCTGTTGGTGG - Intergenic
1075632792 10:124011192-124011214 ACTGCTCAAGCCTCTTTACCGGG + Intronic
1077278459 11:1729590-1729612 ACCGCCCAAGCGTTTGTCGGTGG + Intergenic
1079090129 11:17475092-17475114 AATGCCCAAGCACCTTTCTGGGG - Intronic
1089128897 11:116196698-116196720 TCTGCCCCTGCCTCTTTCTGGGG - Intergenic
1095968300 12:47883949-47883971 ACTGCCCATGCTTCTTGTGGGGG - Intronic
1102030869 12:109739421-109739443 ACTTCCCAAGCATCTTTTGAGGG - Intronic
1102031427 12:109742054-109742076 CCTGCCCCAGCCTCTTTCTGTGG - Intronic
1102963655 12:117110467-117110489 ATTGCCCAAGCCTCTGTCTTTGG - Intergenic
1106052527 13:26205002-26205024 ACTTCCCAAGCCGCTTTGGAGGG - Intronic
1116189610 14:41647345-41647367 AATGCCCAAACTTCTTTGGGTGG - Intronic
1118454455 14:65931920-65931942 ACTGTCCAAGGCTCTTGGGGAGG + Intergenic
1122188113 14:100017539-100017561 ACTGCCCACGCCTCTCTCATAGG - Intronic
1128869104 15:71138733-71138755 ACTGCCCAGGGCACTTTCTGAGG + Intronic
1128992869 15:72275001-72275023 CCTGCCCAAGGCACTTTCTGAGG + Intronic
1129874256 15:78962316-78962338 AGGGCCCAAGCCTCTTACTGTGG + Intronic
1132179875 15:99744219-99744241 ACTGCCCAAGACTCTGTTGCTGG + Intergenic
1135518230 16:23152959-23152981 TCTGCCCAAGCCTGTTTCTCTGG + Intergenic
1138128447 16:54457571-54457593 CCTGCCCCAGCTTCTTTGGGAGG + Intergenic
1138517442 16:57544105-57544127 GCTGCCCAACCATCTTTGGGAGG + Intronic
1139466833 16:67158792-67158814 ACTCCCCAGGCCACTTTCGAAGG - Intronic
1140222843 16:73056807-73056829 ACTGCCCAAGCCTCTTTCGGAGG + Intronic
1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG + Intronic
1148451029 17:47778030-47778052 ACAGCCCAAGCCTCTGTAGCTGG - Intergenic
1151403306 17:73870520-73870542 ACTGTCCAACCCTCTTTTGCTGG + Intergenic
1152452244 17:80389067-80389089 ACTGCCCAAGCCACATGCGGGGG - Intronic
1162450016 19:10748935-10748957 CCTGCCGAAGCCTCTTCCTGTGG + Intronic
1163363634 19:16863877-16863899 ACTGCCCCAGTCTCGTTTGGAGG + Intronic
1166641497 19:44498493-44498515 TCTGACCAAACATCTTTCGGGGG + Intronic
1168342754 19:55635180-55635202 CCTCCCCAAGCCTCCTTCGCAGG - Intronic
927757353 2:25719691-25719713 CCTGCCCAGGCCTCTCTGGGAGG + Intergenic
927911322 2:26901948-26901970 CCTGCCACAGCCTCTTTCAGAGG - Intronic
935455230 2:103259631-103259653 ACTGCCCAAGCCAACTTCAGTGG + Intergenic
935474948 2:103507670-103507692 CCTGCCCCTGCCTCTTTCGATGG + Intergenic
935584700 2:104790266-104790288 ACTCCCCAGGCCTCTTCCAGGGG + Intergenic
946653961 2:221924725-221924747 ACTGCACAAGACACTTTTGGTGG + Intergenic
1173523047 20:43713085-43713107 ACTGCCCAAGTCTCTATCCTTGG + Exonic
1176189902 20:63803572-63803594 GCTGCCCAGGTCTCTGTCGGAGG + Intronic
1180881138 22:19204268-19204290 GCTCCCCAAGCCTCTCTCGCTGG + Intronic
1183356987 22:37364842-37364864 ACTGCCCAAGCCTTTGTTCGGGG - Intergenic
949350391 3:3119643-3119665 ACTGCCCCAGCCTCTTGCTTGGG + Intronic
950119521 3:10472395-10472417 ACTGCCCAGACCTCTTGCTGGGG + Intronic
950770208 3:15305278-15305300 ACTGACCAAACCTCTATCTGGGG + Intronic
954221734 3:49158971-49158993 ACTGCCCAAGCCTCTTTCTTGGG - Intergenic
954421040 3:50419135-50419157 AAAGCCTAAGCCTCTTTCCGTGG - Intronic
954797149 3:53167299-53167321 GCTGCCCAGGCCTTTTTGGGGGG + Intronic
960845259 3:121998844-121998866 ACTGCCACAGCCTCTGTAGGTGG - Intronic
983966989 4:173824417-173824439 ACTGCCCTGTCCTCTTTCAGTGG - Intergenic
985797703 5:1975534-1975556 TCTGCCCAAGCCTGTGTTGGTGG + Intergenic
986708064 5:10467844-10467866 AATGCCAAGGCCTCATTCGGAGG + Intronic
988948289 5:36230027-36230049 ACTGCACAAGCCTCTGACAGGGG + Intronic
1002541381 5:179908392-179908414 CCTGCCCCAGCCTCTTTAGCTGG + Intergenic
1019917048 7:4140293-4140315 ACTCCCCAAGGCTCTTCCCGAGG + Intronic
1022113642 7:27245699-27245721 ACTCCCCAAACCTCTCTCGGAGG + Intronic
1023741616 7:43286321-43286343 ACTGCCCAAGCCTATGATGGGGG + Intronic
1034741178 7:153474899-153474921 ACAGCCCAAGCTTCTCTCGTAGG - Intergenic
1037894424 8:22642310-22642332 ACAGCCCAGGCCTGTTTTGGGGG + Intronic
1046125497 8:109901428-109901450 GGTGCTCAACCCTCTTTCGGGGG - Intergenic
1049696284 8:143985724-143985746 GTTGCCCAAGCCCCTTTCTGAGG - Exonic
1061660632 9:132127940-132127962 ACTGCCCACGCATCTCTCGGGGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1185861581 X:3584413-3584435 ACTGCCAAAGCCTCTATTGCTGG - Intergenic
1188047111 X:25438677-25438699 CCTGCCCCAGCCTCTTCCAGTGG + Intergenic
1189092248 X:38096902-38096924 ACTGCCCATCTCTCTTTTGGAGG - Intronic
1194072947 X:89350421-89350443 TCTGCCACAGCCTCTGTCGGAGG - Intergenic
1200727187 Y:6686161-6686183 TCTGCCACAGCCTCTGTCGGAGG - Intergenic
1200728339 Y:6701936-6701958 TCTGCCACAGCCTCTGTCGGAGG - Intergenic