ID: 1140224474

View in Genome Browser
Species Human (GRCh38)
Location 16:73066872-73066894
Sequence TCCGTATCCCGCGGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140224474_1140224484 -2 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224484 16:73066893-73066915 GAGGTGAGAGCACTGAGATGGGG No data
1140224474_1140224483 -3 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224474_1140224489 28 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224489 16:73066923-73066945 ACCCAACTGCAGGAGGACGCTGG No data
1140224474_1140224486 21 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224486 16:73066916-73066938 ACCCTGAACCCAACTGCAGGAGG No data
1140224474_1140224485 18 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224485 16:73066913-73066935 GGGACCCTGAACCCAACTGCAGG No data
1140224474_1140224482 -4 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224482 16:73066891-73066913 CGGAGGTGAGAGCACTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140224474 Original CRISPR TCCGTATCCCGCGGGGCTGG GGG (reversed) Intergenic