ID: 1140224483

View in Genome Browser
Species Human (GRCh38)
Location 16:73066892-73066914
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140224478_1140224483 -6 Left 1140224478 16:73066875-73066897 CCAGCCCCGCGGGATACGGAGGT No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224471_1140224483 1 Left 1140224471 16:73066868-73066890 CCTCCCCCCAGCCCCGCGGGATA No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224467_1140224483 5 Left 1140224467 16:73066864-73066886 CCCTCCTCCCCCCAGCCCCGCGG No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224475_1140224483 -4 Left 1140224475 16:73066873-73066895 CCCCAGCCCCGCGGGATACGGAG No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224474_1140224483 -3 Left 1140224474 16:73066872-73066894 CCCCCAGCCCCGCGGGATACGGA No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224479_1140224483 -10 Left 1140224479 16:73066879-73066901 CCCCGCGGGATACGGAGGTGAGA No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224469_1140224483 4 Left 1140224469 16:73066865-73066887 CCTCCTCCCCCCAGCCCCGCGGG No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224472_1140224483 -2 Left 1140224472 16:73066871-73066893 CCCCCCAGCCCCGCGGGATACGG No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224476_1140224483 -5 Left 1140224476 16:73066874-73066896 CCCAGCCCCGCGGGATACGGAGG No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data
1140224466_1140224483 16 Left 1140224466 16:73066853-73066875 CCACAGATGCGCCCTCCTCCCCC No data
Right 1140224483 16:73066892-73066914 GGAGGTGAGAGCACTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140224483 Original CRISPR GGAGGTGAGAGCACTGAGAT GGG Intergenic