ID: 1140225353

View in Genome Browser
Species Human (GRCh38)
Location 16:73072158-73072180
Sequence TCAGAAATGTAGGCCAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140225348_1140225353 -3 Left 1140225348 16:73072138-73072160 CCACTGGGTTGGATAGAAAATCA No data
Right 1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140225353 Original CRISPR TCAGAAATGTAGGCCAGGTG GGG Intergenic
No off target data available for this crispr