ID: 1140227907

View in Genome Browser
Species Human (GRCh38)
Location 16:73093443-73093465
Sequence CAGCTCTTTTGGGGGTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140227898_1140227907 -1 Left 1140227898 16:73093421-73093443 CCGTTTGAGGGCCCCTTTCGCTC No data
Right 1140227907 16:73093443-73093465 CAGCTCTTTTGGGGGTTCCAGGG No data
1140227895_1140227907 19 Left 1140227895 16:73093401-73093423 CCACAGCTGATCACTTTGGTCCG No data
Right 1140227907 16:73093443-73093465 CAGCTCTTTTGGGGGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140227907 Original CRISPR CAGCTCTTTTGGGGGTTCCA GGG Intergenic
No off target data available for this crispr