ID: 1140228707

View in Genome Browser
Species Human (GRCh38)
Location 16:73099748-73099770
Sequence CTGTGTGTCCTGCTCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140228705_1140228707 21 Left 1140228705 16:73099704-73099726 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1140228707 16:73099748-73099770 CTGTGTGTCCTGCTCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140228707 Original CRISPR CTGTGTGTCCTGCTCTCAGG AGG Intergenic
No off target data available for this crispr