ID: 1140230383

View in Genome Browser
Species Human (GRCh38)
Location 16:73112844-73112866
Sequence GGTCCTAGCTGCTGCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140230367_1140230383 16 Left 1140230367 16:73112805-73112827 CCCAGACCCCACCCACATTCCTC No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230371_1140230383 8 Left 1140230371 16:73112813-73112835 CCACCCACATTCCTCTGCATCCA No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230370_1140230383 9 Left 1140230370 16:73112812-73112834 CCCACCCACATTCCTCTGCATCC No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230373_1140230383 5 Left 1140230373 16:73112816-73112838 CCCACATTCCTCTGCATCCAGGG No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230369_1140230383 10 Left 1140230369 16:73112811-73112833 CCCCACCCACATTCCTCTGCATC No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230375_1140230383 4 Left 1140230375 16:73112817-73112839 CCACATTCCTCTGCATCCAGGGA No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230368_1140230383 15 Left 1140230368 16:73112806-73112828 CCAGACCCCACCCACATTCCTCT No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data
1140230379_1140230383 -3 Left 1140230379 16:73112824-73112846 CCTCTGCATCCAGGGAGGAGGGT No data
Right 1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140230383 Original CRISPR GGTCCTAGCTGCTGCCCCTG GGG Intergenic