ID: 1140231328

View in Genome Browser
Species Human (GRCh38)
Location 16:73119592-73119614
Sequence CTGTTGGCTCACATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140231328_1140231333 28 Left 1140231328 16:73119592-73119614 CCATGTTCCATGTGAGCCAACAG No data
Right 1140231333 16:73119643-73119665 ATTTCTAACAGTTACATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140231328 Original CRISPR CTGTTGGCTCACATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr