ID: 1140238387

View in Genome Browser
Species Human (GRCh38)
Location 16:73179584-73179606
Sequence CAAACTGCTCACGTGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140238385_1140238387 -5 Left 1140238385 16:73179566-73179588 CCATTTTTGTAGAGGGCTCAAAC No data
Right 1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG No data
1140238382_1140238387 1 Left 1140238382 16:73179560-73179582 CCAACCCCATTTTTGTAGAGGGC No data
Right 1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG No data
1140238383_1140238387 -3 Left 1140238383 16:73179564-73179586 CCCCATTTTTGTAGAGGGCTCAA No data
Right 1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG No data
1140238379_1140238387 7 Left 1140238379 16:73179554-73179576 CCTTATCCAACCCCATTTTTGTA No data
Right 1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG No data
1140238378_1140238387 12 Left 1140238378 16:73179549-73179571 CCAGGCCTTATCCAACCCCATTT No data
Right 1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG No data
1140238384_1140238387 -4 Left 1140238384 16:73179565-73179587 CCCATTTTTGTAGAGGGCTCAAA No data
Right 1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140238387 Original CRISPR CAAACTGCTCACGTGGAAAT TGG Intergenic
No off target data available for this crispr