ID: 1140240636

View in Genome Browser
Species Human (GRCh38)
Location 16:73196769-73196791
Sequence CACCAGAAGGAGGTTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140240628_1140240636 24 Left 1140240628 16:73196722-73196744 CCAAATAATAGACCCATACGTGT No data
Right 1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG No data
1140240631_1140240636 12 Left 1140240631 16:73196734-73196756 CCCATACGTGTAGGTGGCACTTA No data
Right 1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG No data
1140240627_1140240636 25 Left 1140240627 16:73196721-73196743 CCCAAATAATAGACCCATACGTG No data
Right 1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG No data
1140240632_1140240636 11 Left 1140240632 16:73196735-73196757 CCATACGTGTAGGTGGCACTTAA No data
Right 1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140240636 Original CRISPR CACCAGAAGGAGGTTTTGAG AGG Intergenic
No off target data available for this crispr