ID: 1140241005

View in Genome Browser
Species Human (GRCh38)
Location 16:73200581-73200603
Sequence GTAAACAGTCTGACATTTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140241005_1140241007 26 Left 1140241005 16:73200581-73200603 CCGATAAATGTCAGACTGTTTAC No data
Right 1140241007 16:73200630-73200652 TATGACCTGAAAACCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140241005 Original CRISPR GTAAACAGTCTGACATTTAT CGG (reversed) Intergenic
No off target data available for this crispr