ID: 1140242258

View in Genome Browser
Species Human (GRCh38)
Location 16:73213851-73213873
Sequence TCCTCTCAGTTTTCAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140242256_1140242258 25 Left 1140242256 16:73213803-73213825 CCAGTTGAGTGCAGATACATGTC No data
Right 1140242258 16:73213851-73213873 TCCTCTCAGTTTTCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140242258 Original CRISPR TCCTCTCAGTTTTCAGAAGA TGG Intergenic
No off target data available for this crispr